Description :
From Genome Similarity Track
Location :
Scaffold_945:3778- 6060
Transcript NameFunction/comments
Phyag_g8815hypothetical protein

Sequence
2282 bases(100 bases per row)
AAAAACGATGGTGTTTTTGAGACGTCATCGAAGTTGCGAAGCGTGAAGGCGAAACATTCGTCCCTTAGTGACGGAGCGTTGTGCTGTTCTGCTGCCTGGA
GGATACTCGCCACGTTGTCGACACACACTGATTTCAAGAGTTTCTGAGCGCATACCCGCTTGAGACTTTCGATGCCGTACTACCGAGAAAAAAAATCTTA
GTGAATTTTCACGAAATCAAAGTATGATAAACGGCACCTACCCGGTCTGCGGCAATGAAAAGATCTTTGACGGTATCATCCGAAGCAGTGAGGCGATCTG
TGTATACATATTCTAGCAGGGAAAGGAACGTGGCTCGACTGACATCAGAGATTTCCACGTCACGGGCTGTGCTTTCCAACATCTACAGCAACGCACCACC
ATCGATAATTAATGTCAAGCCCCTTTAAAACACACGTATGTCTCGTACAGCTTACCTCTCCGGTAAACATGGCCTTAAAGTAGTTGCAGCGCACACAAAG
ACTCTTGTGACCAAAAATCGGGGTTCCTTCGACTGTTTTCACGCAAAATACCAGCACAGAGATGAACGTGAACGTGAGCCTTCGCTGATCATGATGGTGA
TAAACAAGAAAATAGTTACCTAGGAAAGTGACGTCGCTCATCAGTTGGTTGTTGACAAGTGAGTGCAAATGAGCAATCGCTGAGCCCTCTTCATCAGTCT
CCAGGTTTTCGTGAGAtttggccttggccttcttctcgggcAATTGAAGCTGTTTAAAGCTGGACGAACCATCGTGTTCGCTTAAGACGACCAACTTGCT
GTCATGGACGCAACCAGCAGGCGCGCTGGTTTTGGGAGACGCGCCATGGTAATTGACCGTCGTCCACGTGTTTGTTTCTGTCAGCAAATAGTGATAAGTC
AGTCTAAGTAATAGTGAACATTGAGGTAAGCAATGTTCGCACCAAGATCGAGCTCATATAGGTTCGGGTCTGTCTTTCCGCCAAAGACAATCAGCGAATT
GATGTGTAGAGTTACCAGTGGGTGATGGCAACCTGTCGGCGCCGTGCCCTTTGTCTCTAGACTTGACCAAACACGGGTCTCTGATAACCCAGGAAAAAAA
TATGTTAGAGTACAGCACAAATTCTGCCTGCAGGATTGAACAAGGCGGCGTCTTACCAaagttgaagacgttgaCGTCGTTGAGGTAGCCCAGATCGTGG
TCATATCCTCCGAACAACAAGCAGCTTTGCTCGTACACAACCATCGAAGCTGCCTCACTGGTAGCATCcaaataataataataaaaaaaacaTGTCAGTT
CTGCTCGATTAACACGGTGATAGTTTCTTTGTGACTGTCTTACCGAGGGTATGGCACTTCTCCAGTGGTGCGAATCAACGACCACGAGTTGGTTTCTAGT
ATCGTAAGAAAATAGACACGAAGTCAATACGACACGCACAAACTCCTTTTCCACTTGCAATCACGTACCCAAGTTGAACGAGTGCATGTCATTGACATGG
CGACCCGAGTCCAGTCTACCATATTCACTAGAGCTGCGACTTGACATGGATTCGCGGTCGTAGTGGCTGTCACTTCCACCAAAAATGTACATCGCGTTGT
CTACGCATCACCGAAAACGTCATTTAGATGTGAAATTCGTCCACGCGCTGTGAGTGAGCTGAGCTGAGCATACCGTACACAACCGCAGCATGGCCATATC
TCGGCGTGGGCTGCTGTCCAGCATTAACGAACACGTTGGTCCAAGTTTGCGTCACTGCATTTGCACGATAAATTCACACGTCAGATACGATCAATACTGC
ACATGCAAGTGTGTTACAACTTACGGAAGTTGTAGGAGAAGAAGTCGTTTAAGCGCTTGTCCCCGTCGTAACCTCCAAACACGTAGAACGAGTCCTTGTA
GATCACAGCCGAGTGGCTTTTTCGCTGACTAGGAGCAAAACCATTGCCCAAAACCGTGGACCACTCCTTGCGAGCGAAGTTGAACTCGTAGAAGTTGTTG
GTGGGGCGGATCacagagctgctgcgtgtcgGAACAGCGGGAAGGTTTCGTTCTGCAAAATGCAAACAAGACAAGTCAGTCCACCCCCAAGCAACAGGAG
AGATGCACTAGCGATGGTCCGCCCTCAGGCGGTAGTTCAATTGTAAGTCTCACCTCCGAAAATGTAGAACGAGCCTTCGCGTACAGCGCTGGCGTGGCCT
GGACCAATTAGTGGCGTCTCTCTCGAGTTCACACAGGGAACTGTCGTCCAGGACGGCTGCTGCTCAGTGTCTCCGTTGCTTG