Description :
From Genome Similarity Track
Location :
Scaffold_764:3778- 5700
Sequence
1922 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGCGTTCGAGACGCACATCGGCCT
CTCTGACACTAGCTCTCAGAGCGTACATACTGCTGAGGCCACTAGTGCGGTGCACCCAGCGAATAAAATCGTTGTCTTCTTCGTCCTTTGTTTCGCCTGC
GGACAAGAGAATGGGTACGCCCTTAATCGGTGGAGCCGGTGCACCACGTGCTTGCAACTTAAGGCGTGCCTTGTACTGACTCTGCGTTGTCAGCGATGGA
TCCAGGTACCTCTCACAAAGTGCCTGGCCACTTGCCACTTCCTCGGGAGAGGCAGCTACAGGACCAATGGTCCACGTTGCCAACGTTTAACTAGTCGTTT
GATGTAGACGTTCCTCCACACTGAGTGGAGTGAACACATAGTCACGCTGGTTCCTAAGGGTCGTGACCATTTGCGCATGGAGGCGAGCGCTCTCTTCTCG
TTGAAAAGCCAACTCCTGTTGCTCATCGAGCTGGTTGGTAATGATTGCATCACCACGTTCAGCGAACGGACTTAACGTAGTAGGAGGATGTACCTCAGAA
ATGGGTGTATCGGACATTTTCCTTGCATCGCCCGCGAGACTGGTATCTCTACTGTGGTGAAGCTGATCGAAGCAATTGGGGGAGATCGTTGGGTGGAGTT
ATCTCAAATTGCGACAGTTCATTGAGAAGGATCGATTGGCTGTTAAGCTGCGCAATACCAAGACCGAATATCGCAATATCAAGATCGAATACCACGATAC
CGAGAGTGAATATCGCAATACC