Description :
From Genome Similarity Track
Location :
Scaffold_259:37770- 39834
Transcript NameFunction/comments
Phymu_g7669hypothetical protein PHYSODRAFT_481082
Phymu_g7670TPA: ribosomal protein L35-like

Sequence
2064 bases(100 bases per row)
CTCCAGCCCTGAAGTCGGACACGAAACAAGAGGTAGCAGCACGCCTGCAGCGAATTGAAAACATTAAGCGCACTTTGTTCCTTCAGCGGTTATCAGAGGA
CAAGTCGGCTCCAAAACACTGGAGTAACAAGCAAAAAGCTCGGGTTTTGGAAGCTGCCAGGACGTGGTGTGACTACGGCGAATCTGTGAAAGTCCTCCAA
GGAGAGTGGAAAAACTGTGTTGGAACAATTGTTTCGACACAAAATTTGATGCTGACAGGAAGAGTGCTGGTGTTCGTTCCAGTTGCGAATCGGTCTGCAG
TTGTTCGTTGGGAGGATCTCAAACCGTACGACCAAGACGAAGCCTTGCGTCAAGCCTACGAATCACCAGGACAATTGGCGCTAAACGTCACGCGAGATTT
CCACATCAAAATCTCCCAGATTTTGGAGGCTGCCGTTCGAAGAGCACGTCTATTGTACTTGCAAACGATCGAGTTCAACCGAATCACGCAGTACGCGTGG
GTCGTGGAGTACGACAAGCAAGAACAGAAAGTGGAGTACTGGAACGTGGTTCTCAACAGACGTATCGCAACTCCTCCaaaggcgatggagctgatCGAGA
GGATGGAGATTGAGGACCGtgagaagctggaaaagcGCGTCGAATTGGCCAGGAGCAAGCTTGTCGCGCTTCTAAACCCGTTCCAGCCCAAGAACAAACT
TAAACTGGCGCTACGTAGGAACGCTATTGTGTTTATCTCGAGTGGGGTCGATCCGGAGGAGAGCAACAGCTCAGTTTTATCTCTAAAgcgcgagatggag
gcggTCGACGGCGCTCGCTTTTGGCACGACAAAGTGGTTCCGAACCGCCATTTCGGTGGCAAAAAGGCCAAGAGATTCCTCTCTGCATCTCCGTCAACTG
CTTGCTGGTCGgtcgtgaagctgctcagcTGGATGGACTTACACGAAGACGGAGGCTTCGAGCCgcacgccaagaagttgctgagTCTGTCGGAGGAGCT
GCGGATCTACGTCGTCCGGGAAGTGAGCGGCTGCTTGGAGAGCTCCGAAGACGTCAAACTCGCTCGGGACAAGTTATTgcagctgatgaagctgaaggag
gcgacGTTGCAATTATTAGTGACGAAGGACCACCAAGAtgccgacgaagaagaagcccgaCACGCTAAGCCGCTAAAATAAAGCAACTTTCACTTCAACT
CGTACTTAGCGCAGCCTGTCAACATGATTTGAGACTTCTTGGAAGTCATGAAATGTATGTGGACGGAAGGTTGCTCGAGTGGTTGGACCAGGAAGTCAAA
agcgacgccagcagcgaccAGTCATTCGTCCAGCCAACCAGTGGCCTGCCGAGTCGCTTCATTTGCCTCGCCCACGCAACAAAAGGGAAGTTCGAAGCTA
ACGCATCAACTAGGAAACAATGGGTAAGCTTTAAGTATGGAGGCGCTTTCCTATGGCAATGGACGACGGCGTAAAGGCAGCTACAAGCACAGGCAGGGGC
AGGTTCCGACAGTGCTATCAGGCCCAATCAGTGGCTTGGAATAGAGCGACTCCATCCAGCTTTAGGAACGTATCAAGCGAATCAGGACAAAGATGACGCT
GGCCTTGAACACCGTCAACCGCCTGCCTGCTCGCTTCGCTGCCCGCCCGTTTGATGTATCCAACAGGAGGCCGTAATgcgcaggaagaagatggaTTATG
CTGACTTTGTGgacttgttttttttttcaactCCAGTCCAGATTAAGGCGCACGAGCTCCGCACCAAGAGCAAGACtgagctgctccgtcagctggacga
ctaccagcaggagctggcccAGCTCCGCGTGGCCAAGGTCATTGGCGGTGCCGCCTCCAAGCTGAGCAAGATCCGCGTGGTGCGCAAGTCGATCGCCCGC
GTGCTGACGGTGTACAACCAGAAccagaaggccaagctcCGCGCCGCCCtcggcagcaagaagcacgtTCCCCTGGACCTGCGCCGCAAGCAGACGCGTG
CCATCCGCCGTCAGCTCTCTACGCACGAGAAGTCGCTGAAGAccctcaagcagcagaagaagga