Description :
From Genome Similarity Track
Location :
Scaffold_393:3777- 4988
Transcript NameFunction/comments

Sequence
1211 bases(100 bases per row)
ATCTCGTTCGACGAAGGGATGGTTTCAATGCGGCACCGCCGTAACCCGATGCACCAGTTCATGCCGATGAAGCCCAACAAGTGGGGTACGGTGTTCTACT
TGACGTGCTGCGCCGAGACCGCGTATTGCGCCAGGTACGGAAGTGTTTTCAACGGATGATCCGTTATACCTTCCGTATGTTCCGCGGTTTATTCAGGAGG
ATGCTGAACGTGTTGTGTTCATTGTTTGATTAGGCTTGAAATCTACTGCGGGAAGGCGAACGTCAACGAGGAGGCTGTTGCACAACGTGCTGTAGTCAAG
AATCTTCTGCACGTGCTTCGTGGCCAGCCTGCTCAGCATCTGATCTGCACAGACAACTTCTACACTTCCATCCCGTTGTCACACAAGCTACTCGGTATGA
GGCATTGTCACGTTGGGACCATGCGAAAAGATTGCAGAGGCTGGTGCAAGGCCATTGACTTCACGCAGAAGAGGCGACCCAAGAGGATGCCTCGCGGAAC
GTATCGTTTTAGTGTCTGGCGAGATCATCCTGAGATTGTGGCGCTGGCCTGGATGGACAACAAGCCCGTGCGGTTCCTCGGCACTGGCTGCTCAACCCAG
CTAACGGAAGTCACGCGGCAGGAGCGCGACGGCTCATTCTCAACAGTTCCCTGCCCTAGGCTGGTGCGTGAGTACCATGAAGCTATGGGAGGCGTGGATG
TTCATGATCAACTACGACTACAACGACACTCCATCCAGCGTGCGATTCGGATGAGGAAGTATTACAAGACAATTTTTGTCAGCTTGGTCGATCTGGCAAT
GGTAAACGTGTTCATCGTGCACAAGATCGCGATGCAACGTCGTGGCAAGCCGGTGCCCACACATGCAGCGTTCGTGAGGCGCCTCCACATCGACCTACTC
AACCAAACCAATGAAGACTTTGTTGGTGGAGACGACTTGGAGGATCTCGTAACGGAGCCGCTACCACGCCTTCCACACATCCTAGAGAAGACCGAAAAGG
TGAATGGGAACAAGCGGCGCCAGTGGCTGTGTAAAGGCTGCTCTGCGTATGCTGGTGCTGGCGTGCGGAGCTACGAGACAAGTTTCTTCTGCGCAATATG
CTCACATGAGAAGAAAGGAAGGGTAACGCTTTGCAACAAGCCACGTCGGTTGGGGCACGGCAGAGCCCTCACGTGCGATCAAGTGTGGCATCAGAGCTGG
AAGAATGGGAC