Description :
From Genome Similarity Track
Location :
scaffold_27:37768- 48511
Transcript NameFunction/comments
g1352.t1hypothetical protein
g1353.t1 nucleolin, putative
g1354.t1 conserved hypothetical protein
g1355.t1 conserved hypothetical protein
g1356.t1hypothetical protein

Sequence
10743 bases(100 bases per row)
CGCTGCGCCTTTCGACCATCAGTTTGCCAGCTCATCTGGTTGCCAAGCTGCAACGGCTCCGTAGCTCGCCATGGCACTCCGCAAGTCCATTTCGCTGCCG
ATCGTGCCGCCAGCCAAGCTGCGACGTCGCCAGTCTCTACGGGACGAACAAATGAGTCGCTCGTTCTCGTTCACCAAGCGCCGCGTGGAGAGGCAGACGT
CGCGCCTCACTCCGATGCAGACGATGGAGCAGACACTACTGGATAACGTGCACGTGGAGTTCGTGAAGGCTGTGGTGCCCGGCCAGAACAAGCTGGCCAG
TCCGCGCTACGTCATGCGCATCAGCAACACGGCGCTAGACCAAACGTGGGAGATGGCGAGGACTTTCAAGGAGTTCTACGAGCTCAAAGAAGCCGTTGCC
AGTGTGCTCGACTACGGCCACTTCTGTCCGTCAAACTGCCCGTGGCTTTACATGTACGCGGCGCATCACTTCCCACGCCGCCGCATCTTCCGGTCACGGA
GTCCAAGTGTCATTTCTGGGCGGCTATCCGAATTGCAGACGTACTTTTCGACGTTGCTGCGTATGGCGAAGCAGAACCGCAACTTGGACTGTGCAGTGTC
TTCTACCAAGCTACCGAGACTCATCTACGACTTCTTGTTCGAGGGCATGGTCTTCGATCGCTCCGACTTCACGAGGTTGAGCGAACGACTCTCTATGGGC
GGACGAGATAGCAGCTTCCTTGACAACGACCCGACACAAGATCCAGAGGAATGCTTTATCTGTCGCAAGGCGCTTGTCGGCGACGACACCGTGTCGATTG
TGCCAGCTGCACCAAGCAGCAAACGGGGAGCGTCAAACGTCAACAAGAAGGTCGACAAGCATGTGATGGCAGGTCTGACAACGCTTGACTGCGGCCACTG
CTTCCACGACGAGTGTATCCTCGCGAAACTCAACGAGTCACTAACTTGTCCACTCTGCATAGCGCACTCCAGCCCCCCTCGAAGCAGAATTCTTACTGCC
TAAGTCTCTACAGTAAGTATAGGCAAACTAACGTAGCTCCGACAAACCGTCGCTCATGTTCATAATGATAATGTGACGGCTTTTTGCAGTATTCAAATGC
TCGATGCTGCGTACAGTATCAGCATCATGCCAATTAGCTTTGCCACCTCATCAAAGCTGTAACGGAGTCTGCACATTCAATGTCCGTGGCTCTTCTTGCT
GTTTCTCTGTGCGTTTTCTCGTCTACAGTACACAAAGGGACAGCAACTTGCTGGTGCGCAGCTTTTTAACCCTTTCACTAAAAATGGCTACATTTTGGAG
TACCCCACATAATGTAGCCCGTTCCACATTCGAATAGCCAACAAAATGCAGCGCAGTCGAGTCCGCAACCAGGAGGTGCGTCTTCCTCCCTCTCTTGTTC
TTCCCACCCGAACTACCCCTTTACCGCCTTCTACACATATTCACGCTCGTTCTCTAACACTCTGTGTTGCTGTTTCTATTGAAATCACGCAGGTGACAGA
CGCGCAAGGCCGTCGACGCTTCCACGGAGCCTTCACTGGCGGATTCTCGGCTGGTTACTACAATTCGGTGGGCAGTGAGGAGGGATGGACACCCAAGACC
TTCTCTTCTTCTCGTGGTAATCGCTCGGCGCGTATTGACCAGCGTCCTGAGGATTTTATGGACGAGGACGATGATCCGTTGCTTGGTAAACGACTGGAGA
CCACGGAGCGCTATGACACGCTGCAAACAGGAGCTAAGAAGCGGGTGCAACAGCAACAACCAGCTCCAGCTCAACCTGCTGCTATCCCAGAGTTCTCATT
GCCAGAGGACTGGGTTTTACCTGTCGACGACTCCATTGGAGCTACACTTTTGAAGCAAATGGGCTGGAAAAGAGGTCATGGCATTGGACAACGAGTTCGA
AGACGCAAGTACCAAAAGGAAGAGAAGAAGGGAGATGCCTCAAAACAAGGAGAGAAAAATGATGTCGTGGTACAAGATGAAGCTGAAGAGGAGGTCTATG
TTCCGTCACGAAAGGTGTTTGATGTGGAAAAAGCGTTTCCGAAACCCAAACTGGATCGATACGGAGCAGGTTTTGACCCATACAGAGATGCCCCAGAGTT
CTCGGTGCATAAACAACAACAGGAGCAGAAGCTGAAAGAGAAGGAAGGATCCCACCGACAGGTGGTTTCGTTCATGGACGCGTTGAAGACGAGCAACGGC
AGCAATCGCGCAACAACAGGGTATGGTCTGAGCTCACTGGAAGAGAACGACGATATTGACGTGTATGGAACAGTTTCGATGGCTGAGTTTGATCGAGTGA
TCGCACCACTTGGAGCAAGGAAGGACGTTAAACGCCTGGACTCGTCAGCACTAGAGTCACGGCGGCATGAGAAGCGGTGCAGCCGAGCGTTGTGCTCTGA
TGGACGGCCAGTACTTCCAGGCTTCGAGCTGGCGAAGGCCAAAGAGAAGTTACCAAAGGTAGTAAACCTACGGCTGGTTGTGCCTCCCGGGTTTAAGGCG
TATCACCACTTTAATGATGGTGGCGGCCAGGATGACGCAGTGACAGCCCTGTACCGCAAGTACAATTTTTCGACAGATACTACAAGCTCTGGCCTGGCCG
TTACAGCGAAACAGAGAGGTGTTCTACTCGGAGACGCTGAGCAAGATGCACCAGGCAACTCGGGTACAACAGCTGCTGGTAAAGTGAAAAGCTCAAGTGG
GAGTGTGTTTGATTTGCTGGGAGAAGACCAAAAAGCAAAGCTTCTTGATGCTGTAGCTCAAGCAAAGCAAGGTTTACATCGGGCGCATACTACGACAAAG
GAAGAACCGATAGCTCCAAAAACCCGGCAGGCTTTAGTGAGTGGCAGTGATGGCGATCATTTTCGTGAAACGATTTCTGCGTCTATTGCAAAGAGATTCG
TGTCGGCGAATTCCACGTTGGATGGAGATAAAGGTGACGCTCCTGCTGCAAAAGAGCCCCAAGCTAAGCTGTCGCGTCGGTCGCAGAGTTTATGGATTCC
GAAGTCGCTGCTTTGCAAGCGCTTTCATGTGAAGTGTGCCGGACCAACGGGGGCCAGTGGAAAAGACGAGGAGAATGACAAAAAGCAGGACTTGTTTGAC
AAGGAGCTTGTTCCACACTTGATGGAGTTTGCTGCTGACCGAGCTGCCCACCAGAAGTCAGAAAATGAGGTGCGTGAGACATCAAAATTCACTGCAGGTG
TTCAGGGCAATCCTACAGAGGATATACCGGCAGCTTTGACGCCATTACCTCCAGTCGAAAAGGCATCGACGGATCTACTCAAATCCATTTTCGAGCCGTC
CGACGAGTCAGAAGTCAGTGAAGACGACAGCGAAGATGAAAGTGAAGATGACAGCAGTGACAAGCAATCCCCGCAGAAAACCTTTTCACGTGAAGACGCA
GATAATCAGCGAGATCGAGTACATGTACAAGGGAGCTCAGCCGAGTCGAGTTCATCTGACGATGATGATGGCGTCTCTGCTTTCGTGGGCGAACTTAGGA
GTGGAGACCGTCAAGACACTCGAAGCAACAAGCGACGTCACAGTGTCGATGTCGTTGCTAGTCACGACGATGGGCAGCAAGTGGAGGAAGAGAGACGGAA
ACACAAAAAACACAAGAAGCACCACAAGCACAGCACGTCGCGGGATGAAAGGGGAAAGAAGAGGAAAAAGGGCAAAAAGGAACGCAAGGAGCGAAAGTCC
CACAGTCACCGGTCATCGAGACACTCGAGGCGAAGTCGGAGTCAGAGTGCAGAACGCAGTTCTCGTCACCATCGTAGCTCCAGCAGACGGCACTGATGAG
TTGATATCACCCGATTCAGCCAGTTGACTCGCGTTGAACATTATTTCGCGTGGGCAGTCATATCAAACACGAAAAAACACACTTTGAAGTCTATGTAAAC
AGAATCGATTGAAGCTCAAAGCAATGCAAAACTAGTCAATACACGACAGAGAGCTCCGACTGTGCAGTCCCTCTACCGAGTCAAGCACCCGTTGCCTGGC
GCTATAAGCACAAGTGTCTCCCTGAGGTCGCACCCCTGACCTATGCGAATGTTGCCCCATTAAATTAGTCGAAAGTCATCTTGTTACCCTGGAAGTTCTG
GATGGAGCTCGACTGACGCTTGGGCGGGCCATCACCGCGGCCACCACGTCCACGGCCACCGCGACCACCGCCGCGTCCCCCGAAACCACGGCCGCCACCA
CGACCACCGAAGCCACGGCCACCGCCACGTCCACCATCGAAACCACCACGACCTCCACGGCCGCCGCGGCCACCGCCACGGCCACCAAAGCCACCGCGGC
CACCACCGCTGTGCTGCTCACGCGACTTGGCGTAGTTGACACGGATAGCACGGCCGTTCACGTACGAGCCAGCAAGCTTGACGGCCTCGTCAACAGCCTC
AGTGGTTTCGAAGTCCACGTGACCGAAGCCACGGAACTCACCAGTCTCACGGTCCGTAGCAAGACGGCAGCTAAGGATCTCACCACATTCCCCAAAAGTC
TCACGAATGGTGTTCTCATCCACGTCCCAAGAAAGGTTGCCAATGAAGACGCTGGTGCATCCCTCCGGCTTCTCGTCAAACATGTTCTTCTTCTCGGCCG
TACGGATCTTCATCCAACGACCACCGAAGTCCTGGCCGTCCATAGCAAGACCAGCCTCCACAGCCTCAGCGGTAGTAAAAGTCACAAAAGCCGTACCAGA
CGAGCGGCCGTTCTGCAGGGGGATACGAGCGGCAGTCACTTCACCGCAACCAGCGAAGTGCTCCTTCACCTCGTCCTCAGTGGCAGACCACGGAAGACCA
GCAATGAAGATCTCAAGAGTCTTCTGGGGGTTGGCCACAGCAGCAGCGTCGCCGTTCTCCTGCTTCTGCACCTTGTTAGACGTCTCACCCGCGTCCGAGT
TTTTACGCTTCTTAGCGACAACAGGGGTTTCCTCCTCATCAGAAGACGAGTCAGAGTCGCTCGACGACGACGAAGATTCCTCCTTCTTGGCAGCAACCTT
CTTGGCAACAGGCTTCTTAGCCTCCTCGTCATCCGACGAGTCCGAGTCCGAAGACGAACTGTCCTCCTCCTTCTTAGCAGCCACCTTCTTGACAGGCGCG
GCCTTCTTCTTCGGGGCCTCCTCATCCGAGGACGAGTCCGAAGAGGACGAAGAGCTCTCCTCCTTCTTAGCAGCCACCTTCTTGACAGGCGCGGCCTTCT
TCTTCGGGGCCTCCTCCTCATCCGAGGACGAGTCTGAAGAGGACGAAGAGCTCTCCTGCTTCTTGGCAACAACCTTCTTGGCAACAACCTTCTTAGCAGG
CGCAGCCTTCTTCTTAGGAGCCTCCTCCTCGTCTGAGCTCGAGTCCGAAGAATCCGAAGAGCTCTCCTCCTTCTTAGCAACAACCTTCTTAGCCACGACC
TTCTTGGGAGCCTCCTCTTCATCGGAAGAAGAGTCCGAGGACGAGTTGTCCGAGTCCACGGGCTTCTTCGGGGCGTTCTTGGAGCCCTTCTTCGCAACCA
CCACCTTCTGCGGCGCCTCGTCGCTGCTCGAGTCCGACGAGCTGTCGCTGCTGGACGCAGGCTTCACTTGAGCTTTCACCTTCTTGGCCATTTTATTGTA
CTGTAGAGGAACCGACGCGTCTGGTGCTGTTGAACGATTGCCAAATGACCAGCAAGAACTCCGTTGGCTGCAAGGCGCTTGATACCTTCAATCTGCGCAC
GCAGTTTGGTTGGCTGTGCGAATGCATGGTACAGTGTACCGCAACACAAATTGTGTGGTGTACATGAATCCAGTTTCTGGTGCCAAAGACGTGTGTATGC
CACACGAGATGTGTGGCGCACAGCTATTTGAGGTTTTTTCCACGGAATAGGGGGGCGAGGTTTTTGGTGTTTCACTTGTGGATCGCGCCACATCAGACCA
CACCGCAGTCTTTCTTTCGAATCGATCCGACCAATCCGCGCCCAAATCTCTTCACCTTACCATTATGGTAGCAAGCGGCGCCGACGAGAACTCTCCAGTG
GACGACGCGACGCAAGTGGTGCTGGAAGACGTGGACAAGGTGGACCACGAGGCCATCGTGGGCGAGAAGCGTCCGCGTGATGACGATGACGATGTCGAGT
CCCTCGTGCCGAATGTGGACGCTGTCTCGGACTCCGTTGTCGATGATGCCTCTGTCGAGTCTGTCGACTCGCAGGCCACGCACAACGTCGTGGATCTCGA
CGTTGTGGCCAAGATGAAGGATGCCGTGGGCGTCGACGTTGCATTTGACGCTGCTGCTGCGGCTGCAGCCGTTGTGCCGCCTCCGGAGGGACTCAAATCG
GAATCAGCCACACCTGTGCAAGATGCGGTCGTGGCTGCAGCTGGTGCTGGCGTCGGAGCTGACCCGAACGTGCCTACGAACGTCAAGTTTGAAAGCAAGC
GCATGGCCCGTGTGTCGTTCAACTCGTGGTTCGACTTTGATTCGTACTTTGAAATGTACATGCAGGAGACGTTCCAGCCCTTCCGTATGCGATCATCCTG
CAGTGTCGATGCCTACCGTCGCAACCAGCAGAAGGTCATGCTCAACAATAAGAGCTCGCGTGGTCGCCGTGCTGAGTTCCCTGATGAAGCCATCCACCAT
CACCGGATATACATGTGCACGCACGCCATGAAAGCGAGGTGCCGCGGCGCCAACACCCGCCCCGGACAGAAGTACCGCGGCATCGGCTGCATGGCCAAGA
TCAATGTCAAGATCACCCCAGCCGATAGCCCCTCGAAGTACATGGTCATCGTCACGGACCAGGTAAGCTCTGCTGCGTACTTCAGTGCTGGTAGAAAAAA
TCAGTATTGACTCATGATACGTTACATGTGCTACAGGTTGTCAGTCACAATCACCCAGTGAGCCGCGAGATCTACGAGGCGTACCCGGACGTGTTGCTAA
AGATGATGCGACGCAGCCAACTGACCCAATCGATGTTGGGCCACCCGCCTCCGCCCAAGTTCGAGACGCCCCAGCAGACGCAGAAGTACGAGCGCGCTAT
GAACACGTTCCAGTCGGTGGCGGAAACCATGGCACGGCTGAGTGACGAGGACTACGAGGCACAGCTTGGCCAGCTGCAGCGGCTCTACACGCCCGCAGCG
GAGCAAGATCAAACGGTCTAAAGTAAAGTCAAGCTGCCTCTGCTCATCTAGGACCCTGTTGGTGGCTATACAATACGGGATGAGAAGAAGCTGTCAAGAG
GAACTTACCTGTACCACGTGAGCAATTTTCATCAAAAATGCAATTTGTTTCTTCTTATTCTGTCAACAAAAACTCAAATCACACAAAAATAGTCGTATCA
AATTAGGGGAAACTGTCAACAAATTATTAATACTACTCAAATCACAATAGTAAATTAGGGGGGAAATATCAAATTAGGGGGGAACTGAGAACAACGAGCG
ACATCTGCGCGTAACCTTCACCGGAGCGATGGCGAGTAGCGGCGTGGATGTGGCCCTGGCGCCCAACTCTAGCGTGATCTTGGAGCCAGCGGACTCGCTG
TCCTTCCACCTGCAGCCTCAGACGGCGCCCCAGGCGGTGCTGACGATCCGCAACGTGGCGGATGACCGACAGATCGCCTTCAAGGTCAAGACCACGCGGC
CTCTACGCTACCTGGTGCGGCCTAACCAGGGTCTGCTGGGCCCCAATGGATCGGCCTCCATCATGGTTATCTTACAGCAGAAGGACTGCGACGAGCTGCT
GCGTCTGGACCCAGCCGAGCGCCAATTAGCCAACGACAAGTTCCTGGTGCAGAGCATCTATGTGGACGACAGTTTCTATGAACTTGTGAAGACCAAGAGC
ACGAAGGAGATGGCGGACGAGCTGACTAATATGTGGGCGCGCACGGATAAGCGCGCGTTGTCCAACAAGAAGCTGCGCTGTCGCTTCGTGCAGGACAGTG
AGGATACGGGACGTCCGGTTTCTCCGCTCAGTCCGCAGCGGACGTCATCGGCTAATGCTTCTCCTGCTAAGACGGCAGCTACGTCCGACACGAGATACCA
GACTCAGAGCGACGAGGCCAGGGAGGAAGTGGCTACACCTGCACAGCTTTCGTCTGCATTGCTGCAAGATGACAAGCCCCAAGCGCCTAAAGTGGCGGAG
AACAGGGAAGGAAGTAAAGAAGCCATCCAGGAGGTTGCCGCACTGCGCAAGAAATACGACGAGGTAGGTGGTGCTTGTAGATAACGTGCTGGCGTGAAGT
GGTGGCTGATACTTTCTATGTGAACTCTGTAGTTGGTGGCATTTACAGTGCAGCTTACGGCGCAGCGCGACGTGTTGATGAGCGACCTGGACAAGACCCG
ACAGCTGCTGCAGAAGGCGAGCACGGATGCTCAGCGCGTGAAGAAGCTCTCAGAGGAGTCGACGGGTCTGCGTCATCGGAAAAATGGTGGTGCCACTGGT
GCGTCTGGTAACGAAGACTCGCAGGCAATTAGCAAGGGACCGAATGAGCAAGGAGTACGTGTTGCTTGCTGTCAGTGACGCTGAGGGCTTTAGCAGGTTC
TAACGGTCGTTTTTGACAATGTGTGGCTGCAGGCTTTCGGACCGTTGCATCTACTGGTGTGCGCGATCATTTTCTTTTTAGTTGGGCGCTACTACTAGGT
CGACTGTTGCTGTGTTGGGTGCGCTGGAATTTAGGCAGGGGCGGAGGGTGCTGTACTTCAGACGTGTGACGATAGAGGAACGCTTGGCGAGGGAGCATTA
GAGCTTTCTGTCGGCCTGCGAGAGATGCTGACCTGCGTTCGCACGTAAGTAGGCTCGTAATACGAAGTAGTTGGAACACTTGGCGATCTGGGGACAACAA
GGCAAGGCCACGAAACCAGGGAAATGAATGAATATGGCAACAACCGGTTGAAAAAAGCATTTCAGAAAATCGGTGGTGCATTTGATAAGTGGCAGATGGA
CCACACCTGAACGTCCAGCCTTGATACAACAGTAACAGGCACCTGTAGAGCTACTGACCTACGCGCAATGATGTTGGCTAGTTCAGAATCGCGGTGACGC
TCATTTTGCGCTTGCCTTCCATATCTAGCGGCGCACAAGCTTTGCGTTTAGCACTCCGAGTACGGCAGCTCTCCGTAGCACTGTCACCACCATCGCTGCT
GATTCCAGACGCACGTAGGCCAGCACTATCTTTCATAGAAAGCATAGCAATCGCTGCGGCATCGCTGTCGGACTGGGTACTGGCTGGAGCAACACGCAAC
GGCAGCGGAGGCAGAATGCTGTTTTCTTCCTGAGGTCGTCCACCAAAACGCAATGGCGGCACTTCTGTATCATCGTCAGGGAAGGCACTGTCGTCCGCGT
TGTCCTCGTACTCTCCGTCTCCGTCATAAGCACTCTCAATCTTTCGGAGTTCCCGCACATCATCTCGAAGCGCATTCACTCGAACTAGCGTCACCGAATC
CTCGGATCTTGGGGACGAGTCATCCACAGCACCTCTATACCTGCGTCCGTCGTGACGACCACCGCTTGCACCGGGTGGAGTGTGACTTGGCGAGTGGTTC
GAAGCGTCATTGTTGCCGAACGAGGAGTTGCCACCACCAGTGCCACCGGTGCCGGTGCCGGGGCCTGAACTGCCAGGTGCCTCCCCTATAGGCGACGATG
ACGAGCTGTCGCCACTACCACGTCGAGAAGAAGACTTTTGAGCATCATGCTGCTCGATGCTTGAACCCGTTGCCTGCATGAAAATGTGCTCCAAACGGTC
GATCATCTGCAACAGCGGCTCGTACGTCGCGAAAGGCTGCTTCATCAGGATTGTGTGCATAAACTTGTTTCGTGTAGCATATCCCGTCCACTTATCGTGT
TTTTTCAAGATCTGTAAGACAAAAGGCGCATCAAACAAGTTAGGAGAAGCTTAAAAACAACGCAATACGGGTGGAAATGCTGCCAGGGGACGAACCGCCT
GGCTCGGCGTAAGAGCGCAATGTGTCTAAGATCCGACCTTGGAAATGCCGCAGAAGTTCATCACGGCAAAGTTCTCCAACAGCAGCAACTCCTTGTACAG
CGCGACGCAGCTCTTCATGAGCGCCGTCTTGGCTTCAGCTGACTCGGGGTTCGTCTGAGCAACGCAAAAAACAATATTGTTAGACTTTTGTACCGATGAT
TATCGCGTTGCACTACCTTCCAGCCATCAACAAACTCCTACCTTTAACTGCTGGAAGCTGGCGTCGATGGCTGCCACTTGACTGGTGTGTTTAGCCTGCT
CCTTAATGAAGAAGTCGGCAATCTTCTTGATCTCCATACGCAACGTGCGGAAGAAGTTCATCTCATCCTGTGACTGGCCTGTTGCCACAATGACAATTAG
GTCAATATCAAACATCAATATTCAGTCGAAAGAGGGTCATTACGTACGGATGCTGTCGTTGTCCTCCTTGGCAGACGGCTTGATCTTAATCTTGACGAGT
TTGTCGCCCTGCAGCTTCTCCTCCTTCTTGATCTGCGCGCAGTCCTTGATGATCTTCTTGAGCAGTTTGTAGTCGGCCCAGTAGGGCTCCCAGGCACTGG
GCGACATCTGCGTCGACTGCTGCAGCACTTTGCCGAACTTCATTGCTGTTTCCTTCCACTTGACGTGTGTCTTCTGCCTTCGGTCTGACAAAAAACAACT
GATAACCAGTCAGTCAGGTCCAATGCAATTCAGCACACACATTCTTCCTTGGCCACGCAGTGCCGAGCGCAGTGGAGCGGGGCAACTGGCACGAGATTCG
ATGCAGAGACGAGGAGAAAACACCTGCTCGAATCTTTCAGTCC