Description :
From Genome Similarity Track
Location :
Scaffold_41:3776- 5276
Transcript NameFunction/comments
Phyin_T30-4PITG_15977Cysteine protease family C48%2C putative

Sequence
1500 bases(100 bases per row)
TAAATGACCAAATCAGGTATTTTCCAGGTATAAAACCTGGGATACTCATGTGTGCACGACTTAGGCTAAAGTGGAAATGATCGTAGGCAGTCGACGTCGG
CAACCAATCGTTTTCTTCACCGTTTACCCAGGTATTTTACAGGTTTTAAAACCTGGGCAAATCATGTGGGCGCTACTTAGAAAAATTCTAGAGTGATGGC
CGCTGCGGTGTGTCGGCGTTCACGCTCATGGTGGCGTACCACGAATGTACCATTATCGACTTCTGCCACATACAGTCATTGTCCAGGTTTTGCCCAAGAA
TTGACCATGTATTAAAATCGTTAGTGTCTACATGCATGTTGCACTGACGGATATGCACGAATAACTAGCGCGGCCTCAACTTCATGACTGCGTGCAGCAT
CTCCCACCTCAGCTTCGTAATACCAGCTGGGGACACATCGCTGGGGGATTCGCTGCTCACGCAAGTCCAGAAAAACCGGCACACAAACACACCGCAACTG
TCACTGTCCGTTTGCACCGGCTCGGTTACTTCCAAAGCTTTGTAGGAATCGTCACGTAGAGGCCCAGTACGGATTTCTTCAGCCATCTTCTCCAACCGTT
TCTTGTTTCTCTTACCGCCCATGCTGTCGTACATCTTGACAACCTTGGTGTCTCGGTCAACCACGAGGCATCCCCAATGCGTGCCACCAAAATTGATAGG
AAGAAGCACGAATTGGTGCGAGGCAACACTTTCACCAACTTTGTCGAGCGTGCTTGTAGAGATACGACTTTTGGTGGCCTTTGGTTGGGCTCCATTCTTG
GCATCTTTGGCTTTTTGGGGGGGCGGAATGACGACTGTACAATTGTTCTTGTACCGTGCGAGACAAACCGCAAAAGCACGCATGGCATTATCGTTTAGCC
AAGCGGAATCTCGAAAGCAAAAGAGATTGTTGTACGTCAGGTCGAATCCGAACCCAACCAGCGGTGTATACGGCCAACACTCCAGTATCTTTCCCATTAT
AATACCCGCTGAAGCGGAGTCACTGACCGCGGGTTTAACAGTACTATTCAACCAGGTACAGCAAAGAACAGCATTGCGACAAGTATCTTGTAGCCCCCAC
AAGGATTTCATAGCTTCCAGTTGCTCTCTGGTGAGCTGACCAGCTTTTTCAATTGACACCACGTAACTCTCAATGCTGCCCATTCGTTCACCGTCCCTGT
CCAACTCAATTTCTTCATCTAGCGCCAATCCGCCCCTCAGCTTATCCAACGCATCATCAACAAGCGATTCGACTAGCCTGAATCGCACTCGATCTGGCAC
GTAATCTCCGTCGACGCGCCACTGAATTGACCTTCCCTCACCATTCTTGTTGAGTGGAAAGGTAGTAAGGAAAGACCCAACTTCGCGAACTCCAGGCATG
ATCATCCATAGAGTAGACACCACATCGCAGACGTCGTTATCTCTTAAAAGAGCGCGTAGTTTCATCCCGTTATTGTACTCTTTTAGTGCTAACGCCGCCT