Description :
From Genome Similarity Track
Location :
contig_164:3776- 4977
Transcript NameFunction/comments
g11851.t1hypothetical protein

Sequence
1201 bases(100 bases per row)
TCGCCACGCAGTCGTTTTTGTCGTCCCAGGTGAAAAGCACTGACCCACGCATCGAGATACAGCGTCCTGCAGCTTGGTGGCGAGGCTGTTACCTTCCTCT
CAGCGACCAGGTGAGGGAATACCGTCGTAGCGTGTCGGCAGAAATGGTGACAGTTGTAGTCGTGGTTGCCATCACCAAGTTCACCGAACCACCAATTTCC
AGGCGCTCGAGCTGGATGTTGATATTGTCAAAGTAGACCGAGAACAGGCTCCAATTCTCCAGCAGTGCATCCACCCCGCAAATCGAGCCGTCGGTCACGT
CCGGGGCCATAGCGTTTTGCAGAAAGCTCAGCACGAAGTCACGCAGCAATGGCGGAGGGGACCTGAGGCCAAAGCGGAAAATGCGGAAATACTGCATCGC
CACAGTCCAGACTGTCTGTGTGGTGGGGATGCCGATGTGAGTGTTGCATCGCTTCAGCTCGAGTTCCTGATCTCTTGTCGTAACTTTGAGTTAGCGCTTT
CGAGGGCGAGCGTCACATGCGCTGCTTCTTCCGGTACTCGCCTGGTTCACTCTGCGACGTTCTCACTGTACTCGAGTGTTTTGCTGGTGTTTGCTGGTAC
TGGTAGCTTCGTTGGCCATGCAGGGTTTCGTGCAGGCTTGGAAGGGTGCTTGGGCATTCATGGCTTCCGGTGGCGTTCAATCATGGCCACAGCGGCGTGC
CTGCGATTCGAGTTTGAGCGCTGAGTGACAGCGCAGATCACATTATCACTCAGCGACGTGGTGTTGGGCGGATATAGCGAGAAGACGGGCATGGCTAGCT
TCAATGAAACTTGATAATGATCGATGGTCGACTGAACCACACGAGGCGAAGGAGAGCAACAGCACCACCACGCGATTATGACGTCCAGGTGTACGGATGA
ATACTAGTAATAAACAAGCATAACCTCACTGAGGTCGTAATCAGGCAGAGCATGAGTGATCCTGGACCGTGCTGATAACAACGCCGTGCGCTCTGAAAAT
TTGAAGAGAGTGAGTACATATACTTCGAAGTGTACGATTATCATGCAAACGGAACATTCACGTGGTCACTGCCTTGCTGTCTTTTTAAAAGACCGACCCG
ACCACCACTATTAGCTAGCTGTACACCGAAGCTGTTGCTTGGCGAAGCTTATATGTTTGAGTTAACTGCTACGAAATGGAGTGTTTGAAGGAAGCAGCAC
T