Description :
From Genome Similarity Track
Location :
contig_47:377549- 384533
Transcript NameFunction/comments
g9716.t1hypothetical protein
g9717.t1hypothetical protein

Sequence
6984 bases(100 bases per row)
AAAGGTCTTGGCCACTCGAAGAAGTTGAGCATCCAGCAAAAAATAAAGACGCCGTTGAAGTCGAAGGCAGTGGCATCGCTGAAGCCCAAAACGATGATCC
AGCCACCGCAAGTGGAAGAAGTGCCGGTAAGGCATGTTATAGTTTAGTTCTGCTACCTGCCTACATGCTCACTCTCTTGTGCATGTTCTGGAGGATATCG
AGTTTGCGTACGGCGGACTTTCCTCACCCAATACCGACTCGGCACACTGGGCGAGTCTGCGCGATGAATTTGTGCGCGATATCATCAACGACACGACACC
GACACTCTTCGACGATTTCGATCCCACCGACGTCGTCGCCGGGTGGGATGATGAACGGGAGAAGGCGATGTTGAAAAGTGGAGAGCCCCCTTCCCCGTGG
TGGTCTTCGGCAGATCAGAAGGAAGGCACCGAGGAGGAGAAGGAAGAGGAACACGTACATGACGACCTTGACGATCTGCCACCACCAGATAATCTCCCAG
ATGATGAGGTTGCCGATTTTGATGATGACGGGCTGCTGGGAGATCTCCTCAGCGTGGACGTTGAGGCAGCATGCACCGAATAGTGTTTGCTGTCTTCGCT
TGGTTTGACAACATGCTCCAGCTGATGCTAAAGAAGCCCGTAGCTCAAATCTACCTTTTCGTAACTCCTTCATAACCTATGTAATGCAATATGCAACCGT
TTTACTGAGTACCCATCCGCGCCATCGCCAAGAATTTGACAATGAGATCGTCTCCTGCAGATTGCCAGTCATCAATCGATGCGAAGAAGGAGGCGAGTTG
CTCTTCAGGTGATGGGCCCGTCGAACGCTGTCGAGACGGAATAGACGTCCCACGTTTCGTACAATCCAGCACTTCTTGGGCTCGTTTGACCAGTTCCTCG
GGTATCCCTAGCAACAACAACAACTGGTCTTAGGACTTTCGATCACATTCCCTCCCAAGAACCGAAATAAAACTCACCACACTTTGCAGCAGATGCAAGA
GCGTTACTGTGGCTCGAGATACCGTGGCGCAGCTCGTACAACGGGACAGCGTTTGACGCAGTAGAATACGACTCTGGAGCTTCCGTCGACGCCATAACAG
TGCAGACTACACGCGCCGCGTTGTCCGACGTTTCTGACTGTTCTCCGCTACCTTGAGGTGATGGCTGGTTGGTCACCAGGGATGGCTCAAGCAGATTGTC
GCGAAAGATTTCCTGGATGCAAAGCAGCATTAGCAAATGGCGAGCATGTTGAAGCACAGTTTTGACAATTGTACCAGGAAGTGGGTTGTCAAGATGACAC
GCGGTCTTCCATGTGTAAACGTTTTCGTTGACAAGTAGTTGATTAGTGAACTCTGAGTGGCAACAGTTCGAAATTAGCACCAGAATCAATAGTACAAGTC
GTTCCGTACCAGCAGGGCTATTCCATCCAGCTCTGCAGTTCCTTCACATACGATGTTAGCAAATATGTTCAGGCCCAACAGCATTATGCAAAATCCATGC
AAACCTTTGCCGAATTCATCGATCAAGAACAACGATCGACCATCACCATGATTGAGCATCCATGCCATCTGATTATCACACGTTCATCATAATACTGTTT
GTTGATTTCAAATACTTCGAAGTATTACCTGGTTGCAGTCGATCGTGAAGGAGCTCTGCGATACCGTTGCAGATTCCATGCTACGAAATGTTATCATCAG
TTTCGTTGTGTGTGATATTGAGGTCTCTGAAACTCACCTTTGGATTCTGGTAAACATTTTGGTCACCACTCCTAATTCCGCTGCAATATTTGTTAGAGGT
ATTGTGCCATATAACGTAACTATCATCCCACCTTTCTCTGCTGGTACGAAGCATCCGATCTGTGCCATATATTGCAGAAGGCCAACCATTTTCAAGTACA
CCGACTTGCCTGTCCGGCAAAAGTTAAGCTTGATTGGCCCCCTGAGGTGGCGAAGCCTAGTTGCCTACCTGATCCATTGTGTCCCGTTACAATCTTGAGT
GAATCGCTTGAATCCAGGAAGATGTCGTTCGGGATATAATGCTCGACAAGTAATTCCTGAAGTGGGTGACGAGCTTGGGTCGCCTTCAACGTGTTGGTGG
CGGTGATCTGCGGACTAAACGAACAAGCGTGAGGTAACACAAAGATCGGCAAGTGCTCATTGTCGTTGATTTAGCGTACCGGGAAAAATTGAAGCTCTTT
GCGCAGGAGGCAAACGAGATCAAGCAATCGAGATACGCCATGATCCCAGTTGTATCTGTTGAGAAGTACCAAGCTTATCTACTGGTACTGACGTTTGAAA
CACAAATTGATAAGATTACGAACCATGAATGCTGCTCTCGTACTCTAGAACTGCTATTGTCAGTTCTTCGAGGAGCTCTGCAGAGAAGCAATATTACTTC
AACAGCCCATTTAAACCACATCTTCATATTCGTACCTCTTTGCATGTCAAGAATGTATCCTGCGAAATCATAACAAGGCGCTCATTCATATCTGCCATAC
GAAGCATGTATCAAATAGGTTGATGTACCGTAGATATCTCCGATTGACTCGTCCAAGTCGCGGCAGCAACCATCCTGCCCGAAGAGTCCATTAGTACTTC
GAAAGGGTGTATTAATACGTCGCAGCGCTTGAATTCGTACCTTGTAGTAGAATGTGGTGTCATCTTCTTGAAATTGAAACACGAAGTCGGGCAACGTGGT
GGGCGAATCACAACAGATGACATAGCCTACTTGAGGAATATACTGGACTGTGATCGACGACAAAACAGGATTTGTCTCTTGAATCTGAAACGCGACCTCC
GTCAAAACCTGCCCCCAACACGAATTTGCATTAGAATCTGTTCATTCCCGTTAAAGGGCACCAAATCCGTACATTATCGAGATCTTCGTAGCGCTCTCGT
GCCGCATCCAGGGCTTCCGATATGCCACTTCGGATAATCACTGTATTTTCCTGTTGGCTCTCGTCAAAGTCCACGACGTTCCCGAGAAGATTGCTTACGT
GAATTAATCCATGCTCATTTAGAGCTCTCGAAAATACGTTCGGGAGTGATGCATTGCTCGTATCATTGCAGACACTGTCGATGAGAGACCTAGCACAAAT
GAATAAGAGGTGATAAAAACAATTCATGGCGATTAAAGAGCAACATATGAATGCTTACTGGGTCTCCAGGAAACTCCCAACAGAGGTAGCAAATCGGCAC
CAGTCGCCAACCGAAGCACAGCGCCTCTTAATGCGCTGGAAAATTCCTGCCACATCTCTGAACTGCTTCAGCTTACCAAACTACATTTTGTAAGATGTCG
TCGTGCTCAAAAGACCAAATCAGGGGAAATCCAAGACAATACCAGTAGCTGGCGAAGCTCGTCATTTTTAGCAGCAGTGAAAAATGCGACGGCGCTGAGG
CGCTCATCAATGTGGGCACTGCTAACTAGCGGGGTCAGCATCCAACGGCGTAGCATGCACCCACCAGATTTGGTCACAGTGCGGTTGAGTAGACCAAACA
GACTGAATCACATTGTCAACAAGCCATCATCGAATGAAAGCAAGCAAGAGGAGGAACTAATACCTGAAGCCCTCCTTCGCTCGGCCAGACCCCTGCATAG
GGTTAACGTGAGTATAGTGGCAATTATTGAGAACATGTCGTAGCACACCTTGACTAGTGACGGGTGTGCTTCCTGTATTACATCAAACAAGTATGAGCAG
CAGGCTCGTAAAGTTACCCCGCGGTTCAAGTCGGCCTACACGGTTGAATATCTGAAGGGACTGGAGTGTAGACTTGTCGATATACATGAGCCCGTCGAGT
GCGACATGCTCCACTGTTGAAAAGTGTATAGATTCTGCGTTGTCCAATTGGTTTCCAATCTGCACAAGTCTTTAGTCAAGTCATTGGACGAATATCAATC
CCCCCAACATACCTTTTCGGTGGATAAATAGAGCAGCAATGCTGTAAAAGTTGCTGTCGTCAGTACCAAGTACTCGGCAAGGACGGAAATGAACTCAACG
CTTACCCCCTGTCGCTCGAATCAACTGCGTGCTTTCGAAATCAAAGAAGCTGCCAAGGAACGTGTAGACCTCTCGCCTGTGAAGAGGTTGTATCTGTCAG
CACACGGCCAGTGCCAGCATCACCAAGAGTTTCTGTCTCTTGCCTAGACGATCGACTGTGAGGCGTCCTGAACTCAGCAGGAGCAGCTCCAATTTGCACA
TGCTCAATCGCTTGGCACCCCTTCAGGTAATTAAAATCTGCTTGCCGATATGGTTGAGTGAAGACTCCAGCAACCCCCCCCCCCAAAAAAAAAATTGCCA
ACCTGAATGCTGCGATAGGATAACGAGTTGTCAACAGCTAGTACTTTAAAAGCATGCAAACACAACGAACCTTCCGGACACTGACCCCCGTCTTCGTCTG
ATGCGTTTCGTCGAGTTTCTTGACCATCCGAAGCATTCCATTTGAGCTCGCATTCCGAGAGGAAACAAGCACGTGGTTCACTTCAAACTGTGTGTGCAGG
CGTTCGATGATCTAAGGAGCACGCGCGATCAGCTCTTGGTGTCTTCAATTAGTACAGCAAGACTGCCGCTTTACCTCCTCCAGCTCCTGGGCATCAGCTA
TTTGGAGCTGCAACGTCTTGAGGCTCGTCGTTAATGCGTTGTAGATCGAGACACCCAGTTCGCCTCGGTCGAAGAGAATGGACATGAAGACAAGCTCCTC
GTCGTCGACTTCAACGTCGCTCGCGGCTTCGGACAGCCCCTCCTCGTCTCGTTGCTGCTAGTGCTTGACGTCAGACCAGGATACCCCCCCCTTCCACACA
CACACACACACGCATGAGCCACCACACGGATACCTCTGCTCGACCATGCGCCATCCTGTCCCGCTGCCAGATGTGCACACTTCAATGCGGAATGGAGACG
TGCGTGTTGCCTCTCCCAGGAGTGATGGTCGCTGCAACATATGTGATAAGAAAGGTTCAATATTCGATTAGATGGGGATTTTCACGGTCGAATCACATTT
TCAAACGGTGAGCGTCAATCACACGACTACAAGATGGTACGAGGGCACTATAGCGTCGGCACAGACTTGTGCGTTAATATGATGGTTATGATGCGCTGCT
GTAGGCGACGGCTCAGGTCTCAGAGAACCTCATAACGCTCAAGGGCTCAACTGAGATCGTCACGGAGTTTTTTTCGTATAGCATCAACACGTGCGAGCCC
TTAACAACTCGCACCGCTGTTATTGTGGCGTTTCGCAAAGCTAATAGGTCTATGTGTTTCAGTATTCTGTATCAGCGCGGCATCTACCCTGCTGAAAGCT
TCAAGCAGGTCCAGAAGTATGGCTTGAACATGCTTGTGACCGACGACGACAAGCTCAACGACTTTTTCACGAAGTTCCTCCAGCAGTTGTCGAGTGCGTC
TACATGCAGTTGTATAGCTCTGCAATTCGCGTGTTTATTCACAACGGAAAACTGTAATTATGCTGCAATATACAGGCTGGCTTGTGAAGGGAGAAGTGCA
GAAGCTTGTGCTTGTCATCACAGGAATTGAGACTCAGGAAGTGCTGGAGCGATGGGCGTTTGAAGTGCACGCTGAGAACAGCACAACAGAAAGGTGCGTT
GGCCCCTTGTCAGCATGGCAAGGGGATAATTGCTGATGCCGAATTTGTTGTTTGTCATGCGGGCTTCGTAGTGGGGGTGCTACCAAACCCAAGAAGGAGA
TCATGTCGGAGATTCAGGCCATCATCCGTCAGATCACAGCAAGTGTCTCTTTCTTGCCTCTTTTGGAGGAGCAGTGCGCGTTTGACCTGCTGGTCTACAC
CTCCAAGAACTCGGAAGTGCCTGCGCTGTGGGAAGAGTCGGATCCTCGCTACATCAAGGACTCGGCGGAAGTGCGCTTGCGCTCGTTCTCCACCAAGGTA
CGCAACATATGTATATCGCAAGGCTTGCTTGCTACGTCCATTCAACTAATCACATGGCGTTTGCTGCACAGGTGCACAAGGTCGATGCGATGGTAGCCTA
CAAGAACCCTGAAGCTGACATCTAACCACCGCAGGAATGGCATCTTGATTAGCGGGTGGCAACTGCGCGTCTACTTATTGCTTCTTGTCCTTCTTTTCAA
AACGCGACAGAACGGTCTCGATGTCCTTGTTGAATGCATCTTTGCTGAAATAGCCGTCCTTGTCGAAGTAGCGGCCAACATACAGCTCCACCTTTTTGGG
TGTGTCCTTCGCGTCACCGTGGTGGATGCTGAGAGAATAGTGCGACTCTGTGTACGGAAACGATGTCCGGACCAAAATGGTCTTACCCGCTGAACCCTGC
AACAAATCCACACGTACAAAGGTTAGCATCTCTACCGGCAGTACAATCCTTCTAGGGCAAGCTCACCGTTCGCGTCATCCGCAAGAGGACGTCCTTCTCG
ATGAACGTGGTGTAACCGAACAGAAGCGCGTGGATGAAGAAAAACCTAGTCATGTCCACGATAAAACAACTCTTAGCATCGCGCAGTAACACTAGCGCCA
TACAGATGCATTCAAGCCCATTCACACTCACGCGCCGACGCAGGAGTAGATGAGCACGTGCTCGGGAATCGCGGGATGCTTGAAGAAGTGCGACACGGCC
GCAATGATCGTCGCCAGCAGCATGAACAGCAGCTTGGCGTTGTCCCATCCGTAGTGCAACTTGAATGTGTCTTTCCCCTGGAAAAACTCCACGATGGTGT
CGTCCAGCAGGTTCTTGACTGCGTTCTGGTCGCCCGTCTCGATGTGCAGATCTGCGGTTCTCGCTTCAGTAGGCTGCCAGCGACTCTAGTACCAGCTGAA
ATAGTACGTACCGTTCAGCACCATCTCGTCCTCCGAGTCCTTGCGGTCCGGCGCGGCGGTGCTGCTCGAGGCGCCCATGCTGAGCTGCTTGCTGTGGGTC
GACTGCGGTGATGTGGCACTGCGCCAGATCCCGGTGCGAGTATGACGTATGTCGTTGGACAGGTTTACCTATCAGACAGCATAC