Description :
From Genome Similarity Track
Location :
contig_47:377499- 384483
Transcript NameFunction/comments
g9263.t1hypothetical protein
g9264.t1hypothetical protein

Sequence
6984 bases(100 bases per row)
AGTGAAGGTAACGCGAGTGTTGTTGGTTCTATCAAGAAGACTGGCCTGGGAAAAGGTCTTGGCCACTCGAAGAAGTTGAGCATCCAGCAAAAAATAAAGA
CGCCGTTGAAGTCGAAGGCAGTGGCATCGCTGAAGCCCAAAACGATGATCCAGCCACCGCAAGTGGAAGAAGTGCCGGTAAGGCATGTTATAGTTTAGTT
CTGCTACCTGCCTACATGCTCACTCTCTTGTGCATGTTCTGGAGGATATCGAGTTTGCGTACGGCGGACTTTCCTCACCCAATACCGACTCGGCACACTG
GGCGAGTCTGCGCGATGAATTTGTGCGCGATATCATCAACGACACGACACCGACACTCTTCGACGATTTCGATCCCACCGACGTCGTCGCCGGGTGGGAT
GATGAACGGGAGAAGGCGATGTTGAAAAGTGGAGAGCCCCCTTCCCCGTGGTGGTCTTCGGCAGATCAGAAGGAAGACACCGAGGAGGAGAAGGAAGAGG
AACACGTACATGACGACCTTGACGATCTGCCACCACCAGATAATCTCCCAGATGATGAGGTTGCCGATTTTGATGATGACGGGCTGCTGGGAGATCTCCT
CAGCGTGGACGTTGAGGCAGCATGCACCGAATAGTGTTTGCTGTCTTCGCTTGGTTTGACAACATGCTCCAGCTGATGCTAAAGAAGCCCGTAGCTCAAA
TCTACCTTTTCGTAACTCCTTCATAACCTATGTAATGCAATATGCAACCGTTTTACTGAGTACCCATCCGCGCCATCGCCAAGAATTTGACAATGAGATC
GTCTCCTGCAGATTGCCAGTCATCAATCGATGCGAAGAAGGAGGCGAGTTGCTCTTCAGGTGATGGGCCCGTCGAACGCTGTCGAGACGGAATAGACGTC
CCACGTTTCGTACAATCCAGCACTTCTTGGGCTCGTTTGACCAGTTCCTCGGGTATCCCTAGCAACAACAACAACTGGTCTTAGGACTTTCGATCACATT
CCCTCCCAAGAACCGAAATAAAACTCACCACACTTTGCAGCAGATGCAAGAGCGTTACTGTGGCTCGAGATACCGTGGCGCAGCTCGTACAACGGGACAG
CGTTTGACGCAGTAGAATACGACTCTGGAGCTTCCGTCGACGCCATAACAGTGCAGACTACACGCGCCGCGTTGTCCGACGTTTCTGACTGTTCTCCGCT
ACCTTGAGGTGATGGCTGGTTGGTCACCAGGGATGGCTCAAGCAGATTGTCGCGAAAGATTTCCTGGATGCAAAGCAGCATTAGCAAATGGCGAGCATGT
TGAAGCACAGTTTTGACAATTGTACCAGGAAGTGGGTTGTCAAGATGACACGCGGTCTTCCATGTGTAAACGTTTTCGTTGACAAGTAGTTGATTAGTGA
ACTCTGAGTGGCAACAGTTCGAAATTAGCACCAGAATCAATAGTACAAGTCGTTCCGTACCAGCAGGGCTATTCCATCCAGCTCTGCAGTTCCTTCACAT
ACGATGTTAGCAAATATGTTCAGGCCCAACAGCATTATGCAAAATCCATGCAAACCTTTGCCGAATTCATCGATCAAGAACAACGATCGACCATCACCAT
GATTGAGCATCCATGCCATCTGATTATCACACGTTCATCATAATACTGTTTGTTGATTTCAAATACTTCGAAGTATTACCTGGTTGCAGTCGATCGTGAA
GGAGCTCTGCGATACCGTTGCAGATTCCATGCTACGAAATGTTATCATCAGTTTCGTTGTGTGTGATATTGAGGTCTCTGAAACTCACCTTTGGATTCTG
GTAAACATTTTGGTCACCACTCCTAATTCCGCTGCAATATTTGTTAGAGGTATTGTGCCATATAACGTAACTATCATCCCACCTTTCTCTGCTGGTACGA
AGCATCCGATCTGTGCCATATATTGCAGAAGGCCAACCATTTTCAAGTACACCGACTTGCCTGTCCGGCAAAAGTTAAGCTTGATTGGCCCCCTGAGGTG
GCGAAGCCTAGTTGCCTACCTGATCCATTGTGTCCCGTTACAATCTTGAGTGAATCGCTTGAATCCAGGAAGATGTCGTTCGGGATATAATGCTCGACAA
GTAATTCCTGAAGTGGGTGACGAGCTTGGGTCGCCTTCAACGTGTTGGTGGCGGTGATCTGCGGACTAAACGAACAAGCGTGAGGTAACACAAAGATCGG
CAAGTGCTCATTGTCGTTGATTTAGCGTACCGGGAAAAATTGAAGCTCTTTGCGCAGGAGGCAAACGAGATCAAGCAATCGAGATACGCCATGATCCCAG
TTGTATCTGTTGAGAAGTACCAAGCTTATCTACTGGTACTGACGTTTGAAACACAAATTGATAAGATTACGAACCATGAATGCTGCTCTCGTACTCTAGA
ACTGCTATTGTCAGTTCTTCGAGGAGCTCTGCAGAGAAGCAATATTACTTCAACAGCCCATTTAAACCACATCTTCATATTCGTACCTCTTTGCATGTCA
AGAATGTATCCTGCGAAATCATAACAAGGCGCTCATTCATATCTGCCATACGAAGCATGTATCAAATAGGTTGATGTACCGTAGATATCTCCGATTGACT
CGTCCAAGTCGCGGCAGCAACCATCCTGCCCGAAGAGTCCATTAGTACTTCGAAAGGGTGTATTAATACGTCGCAGCGCTTGAATTCGTACCTTGTAGTA
GAATGTGGTGTCATCTTCTTGAAATTGAAACACGAAGTCGGGCAACGTGGTGGGCGAATCACAACAGATGACATAGCCTACTTGAGGAATATACTGGACT
GTGATCGACGACAAAACAGGATTTGTCTCTTGAATCTGAAACGCGACCTCCGTCAAAACCTGCCCCCAACACGAATTTGCATTAGAATCTGTTCATTCCC
GTTAAAGGGCACCAAATCCGTACATTATCGAGATCTTCGTAGCGCTCTCGTGCCGCATCCAGGGCTTCCGATATGCCACTTCGGATAATCACTGTATTTT
CCTGTTGGCTCTCGTCAAAGTCCACGACGTTCCCGAGAAGATTGCTTACGTGAATTAATCCATGCTCATTTAGAGCTCTCGAAAATACGTTCGGGAGTGA
TGCATTGCTCGTATCATTGCAGACACTGTCGATGAGAGACCTAGCACAAATGAATAAGAGGTGATAAAAACAATTCATGGCGATTAAAGAGCAACATATG
AATGCTTACTGGGTCTCCAGGAAACTCCCAACAGAGGTAGCAAATCGGCACCAGTCGCCAACCGAAGCACAGCGCCTCTTAATGCGCTGGAAAATTCCTG
CCACATCTCTGAACTGCTTCAGCTTACCAAACTACATTTTGTAAGATGTCGTCGTGCTCAAAAGACCAAATCAGGGGAAATCCAAGACAATACCAGTAGC
TGGCGAAGCTCGTCATTTTTAGCAGCAGTGAAAAATGCGACGGCGCTGAGGCGCTCATCAATGTGGGCACTGCTAACTAGCGGGGTCAGCATCCAACGGC
GTAGCATGCACCCACCAGATTTGGTCACAGTGCGGTTGAGTAGACCAAACAGACTGAATCACATTGTCAACAAGCCATCATCGAATGAAAGCAAGCAAGA
GGAGGAACTAATACCTGAAGCCCTCCTTCGCTCGGCCAGACCCCTGCATAGGGTTAACGTGAGTATAGTGGCAATTATTGAGAACATGTCGTAGCACACC
TTGACTAGTGACGGGTGTGCTTCCTGTATTACATCAAACAAGTATGAGCAGCAGGCTCGTAAAGTTACCCCGCGGTTCAAGTCGGCCTACACGGTTGAAT
ATCTGAAGGGACTGGAGTGTAGACTTGTCGATATACATGAGCCCGTCGAGTGCGACATGCTCCACTGTTGAAAAGTGTATAGATTCTGCGTTGTCCAATT
GGTTTCCAATCTGCACAAGTCTTTAGTCAAGTCATTGGACGAATATCAATCCCCCCAACATACCTTTTCGGTGGATAAATAGAGCAGCAATGCTGTAAAA
GTTGCTGTCGTCAGTACCAAGTACTCGGCAAGGACGGAAATGAACTCAACGCTTACCCCCTGTCGCTCGAATCAACTGCGTGCTTTCGAAATCAAAGAAG
CTGCCAAGGAACGTGTAGACCTCTCGCCTGTGAAGAGGTTGTATCTGTCAGCACACGGCCAGTGCCAGCATCACCAAGAGTTTCTGTCTCTTGCCTAGAC
GATCGACTGTGAGGCGTCCTGAACTCAGCAGGAGCAGCTCCAATTTGCACATGCTCAATCGCTTGGCACCCCTTCAGGTAATTAAAATCTGCTTGCCGAT
ATGGTTGAGTGAAGACTCCAGCAACCCCCCCCCCCAAAAAAAAAATTGCCAACCTGAATGCTGCGATAGGATAACGAGTTGTCAACAGCTAGTACTTTAA
AAGCATGCAAACACAACGAACCTTCCGGACACTGACCCCCGTCTTCGTCTGATGCGTTTCGTCGAGTTTCTTGACCATCCGAAGCATTCCATTTGAGCTC
GCATTCCGAGAGGAAACAAGCACGTGGTTCACTTCAAACTGTGTGTGCAGGCGTTCGATGATCTAAGGAGCACGCGTGATCAGCTCTTGGTGTCTTCAAT
TAGTACAGCAAGACTGCCGCTTTACCTCCTCCAGCTCCTGGGCATCAGCTATTTGGAGCTGCAACGTCTTGAGGCTCGTCGTTAATGCGTTGTAGATCGA
GACACCCAGTTCGCCTCGGTCGAAGAGAATGGACATGAAGACAAGCTCCTCGTCGTCGACTTCAACGTCGCTCGCGGCTTCGGACAGCCCCTCCTCGTCT
CGTTGCTGCTAGTGCTTGACGTCAGACCAGGATACCCCCCCCTTCCACACACACACACACACGCATGAGCCACCACACGGATACCTCTGCTCGACCATGC
GCCATCCTGTCCCGCTGCCAGATGTGCACACTTCAATGCGGAATGGAGACGTGCGTGTTGCCTCTCCCAGGAGTGATGGTCGCTGCAACATATGCGATAA
GAAAGGTTCAATATTCGATTAGATGGGGATTTTCACGGTCGAATCACATTTTCAAACGGTGAGCGTCAATCACACGACTACAAGATGGTACGAGGGCACT
ATAGCGTCGGCACAGACTTGTGCGTTAATATGATGGTTATGATGCGCTGCTGTAGGCGACGGCTCAGGTCTCAGAGAACCTCATAACGCTCAAGGGCTCA
ACTGAGATCGTCACGGAGTTTTTTTCGTATAGCATCAACACGTGCGAGCCCTTAACAACTCGCACCGCTGTTATTGTGGCGTTTCGCAAAGCTAATAGGT
CTATGTGTTTCAGTATTCTGTATCAGCGCGGCATCTACCCTGCTGAAAGCTTCAAGCAGGTCCAGAAGTATGGCTTGAACATGCTTGTGACCGACGACGA
CAAGCTCAACGACTTTTTCACGAAGTTCCTCCAGCAGTTGTCGAGTGCGTCTACATGCAGTTGTATAGCTCTGCAATTCGCGTGTTTATTCACAACGGAA
AACTGTAATTATGCTGCAATATACAGGCTGGCTTGTGAAGGGAGAAGTGCAGAAGCTTGTGCTTGTCATCACAGGAATTGAGACTCAGGAAGTGCTGGAG
CGATGGGCGTTTGAAGTGCACGCTGAGAACAGCACAACAGAAAGGTGCGTTGGCCCCTTGTCAGCATGGCAAGGGGATAATTGCTGATGCCGAATTTGTT
GTTTGTCATGCGGGCTTCGTAGTGGGGGTGCTACCAAACCCAAGAAGGAGATCATGTCGGAGATTCAGGCCATCATCCGTCAGATCACAGCAAGTGTCTC
TTTCTTGCCTCTTTTGGAGGAGCAGTGCGCGTTTGACCTGCTGGTCTACACCTCCAAGAACTCGGAAGTGCCTGCGCTGTGGGAAGAGTCGGATCCTCGC
TACATCAAGGACTCGGCGGAAGTGCGCTTGCGCTCGTTCTCCACCAAGGTACGCAACATATGTATATCGCAAGGCTTGCTTGCTACGTCCATTCAACTAA
TCACATGGCGTTTGCTGCACAGGTGCACAAGGTCGATGCGATGGTAGCCTACAAGAACCCTGAAGCTGACATCTAACCACCGCAGGAATGGCATCTTGAT
TAGCGGGTGGCAACTGCGCGTCTACTTATTGCTTCTTGTCCTTCTTTTCAAAACGCGACAGAACGGTCTCGATGTCCTTGTTGAATGCATCTTTGCTGAA
ATAGCCGTCCTTGTCGAAGTAGCGGCCAACATACAGCTCCACCTTTTTGGGTGTGTCCTTCGCGTCACCGTGGTGGATGCTGAGAGAATAGTGCGACTCT
GTGTACGGAAACGATGTCCGGACCAAAATGGTCTTACCCGCTGAACCCTGCAACAAATCCACACGTACAAAGGTTAGCATCTCTACCGGCAGTACAATCC
TTCTAGGGCAAGCTCACCGTTCGCGTCATCCGCAAGAGGACGTCCTTCTCGATGAACGTGGTGTAACCGAACAGAAGCGCGTGGATGAAGAAAAACCTAG
TCATGTCCACGATAAAACAACTCTTAGCATCGCGCAGTAACACTAGCGCCATACAGATGCATTCAAGCCCATTCACACTCACGCGCCGACGCAGGAGTAG
ATGAGCACGTGCTCGGGAATCGCGGGATGCTTGAAGAAGTGCGACACGGCCGCAATGATCGTCGCCAGCAGCATGAACAGCAGCTTGGCGTTGTCCCATC
CGTAGTGCAACTTGAATGTGTCTTTCCCCTGGAAAAACTCCACGATGGTGTCGTCCAGCAGGTTCTTGACTGCGTTCTGGTCGCCCGTCTCGATGTGCAG
ATCTGCGGTTCTCGCTTCAGTAGGCTGCCAGCGACTCTAGTACCAGCTGAAATAGTACGTACCGTTCAGCACCATCTCGTCCTCCGAGTCCTTGCGGTCC
GGCGCGGCGGTGCTGCTCGAGGCGCCCATGCTGAGCTGCTTGCTGTGGGTCGACTGCGGTGATGTGGCACTGCGCCAGATCCCG