Description :
From Genome Similarity Track
Location :
Scaffold_190:37749- 40712
Sequence
2963 bases(100 bases per row)
GGTAGCGGTTCTTTGCACCAGGAGGTTAGTATCGACCCCGTGAATCAGACAGCTACGCCGGGCTAACGCTAGAACAATCCAACCCAAATAGAGTTATACA
CGTTATACAATCACACAAATACTCCTTTGCCCTCTCTTCTTTCTCTAGGCCCAAGGCTAAGGCCAAAACACAAGTCAACTGGTCCAAATCCAAGACACTT
GATCAATCTTGGGGACGCGCACCACCTCTCGGAGAGAGGAAACAATCTACCCTGTCGCCAACTTCTTCAGTTCGACACAAGCCCAATAGACCGCAAATAT
ACAGCAAAGACGGTCTGCAATCCGCCAAATATACAGATATGGAATATATATGATCACCTCCAGGCCGAAGCAGTGGATCACTTACCTAAAGTACTTTGAA
TTTTGTCGTGGAGAACGGCCTTCCAGGCTGTGAAAGAAGCACTCGTGCCCTTCGAAGCAAAACGAACTCTGTTTGGTTAAAGGTCACATGCAGACGAAAT
CTTTCCTAAGCGACTCCTCGGAGACTGCGATTTTTCGGCGGAGTGTTGGTCTGACCGTGAAGGGTCGCCAGACTGGATACCTTCTCGGAGTTGTTGGGTA
CACCTCGGATCTTGGAAGATGCCATAGTGAAACCAAGTGTTCTTGGGTTTGGAGCCTTGAAACGCCTCGCACAGAGGCTGCTCTTGGACTTTTGTGGGAA
GTAAGTCTGAGGACACGAACGTTGGGAGTCGTTATTCTGGGAAAACAACGGGGAATCTGAGAAGTGCCTCAGCTCCCAGGTTGTAAGCCAGAGTCGAGTT
CCGCCTCGCGCAGATTCGTAGGGAAGGTCGCACACATTCCTGTGCACTTCTAGGAACGGGATCCATTCGCCTACACCGACCTGCTTTCCGGGGTCTCACT
TTCGCCACAAACATACTCTTGTTTTTATTCGGCTCCAAGTCCAGCACGAACTCTCAGAATCCCAGGCACGATTGTCGGGTTCCAAGAATGTACCACTTAT
CTGGTACCGTGGTCATCATTCTTGACCAACATATTTCCACCAATCCGCGAACTCCACAATCTGGGCAATTCCCGGGTTTTGGTCCCATGACCCAAATTTT
AGTGACGGCACCGCGTAACAAATCTACATTGACGAGAAGTGGTTTTACATGACCGAAGCCGACAGAACGATCTGCATGGCATCCAACGAGACACCGCCGC
ACCGAACTGTCCAGTCAAAACGCTTCACCACGAAGGTTATGTTCATGGCTGCTGTGATGCAGCCTATCTACGGTGCTGACGGGTCCATGGTCTTTGACGG
GAAGATCGTCATGTGGCCCTTCGTGGAGCGCGTTTCAGCTCTGAAGAGCTCTCGAAACAGAGCTGCGGGTACGCTGGTGACCCGTTCTGTCAACGTCGGA
CGCAAGGAGCAGATAGCGATGCTGATTGATAACGTCATTCCCGCCATCAAGTCGAAGTGCCCTCCTACGCTCCGCGGTACTGAACTCATCATTCAGCAAG
TAGGAACTCGCTGTCATGTCAGCCCCCACGACCCATTGATTCATGCAGCATGCCAGGAAGGTGTTTGGAAGATCACTCTCGATGTACAGCCGCCCAACAG
CCCCGACCTCAATACGCTTGATTTGGGGTACTTCTGCTCGATTCAAGCGCTTCAGTACGAGGAGTGTCCACGCAATATCGACGAGCTGATTGCCTGTACG
GTCGCGTCGTTGGCGAACCGGAAAAATAGCGCACGTGAAGATACTTTTGTGTCACTGCAGAAGGTTATGGAGTGCATCATCCAAGACCACGGAAACAACA
GCTACAAGCGACCTCACATTGGGAAGGCCAAGCTTCGTAAAGCCGGACTTCTCGGAAGAAACTATGTGTGCGATTCGTCCGTGTACTTGGAGGGTGCTGC
CTATCATTTTCTAGCAAGTCACGATAGAGCTGAGAAGGAAAAAAAAAACTGCTGAGGTTGCAGGTAGAGGCTTTCAAGATTTTAACACCACAAGAATAAA
TGCGTGTTATGTTGATACAAAGTGGGCTTTGGGCACGTAGCTCAATTGGTTAAGAGCACCGCCATTTGTGCGGAAGGGCGCGGGTTCGATTCCCGCCGTG
TCCTTAATTTTTTAATAATTAAAAACTAGGATTTACCGAGAAGAAAGCCCTAGTCGCGATTATAATGCACAGACGTCTATTCTCACTTGATTATTGTATG
GACCAACGACGTTCTGGACGCTGCAAAGGAGGAGAAATGCCGTAAATCTGCATGATTATCACGCCATGAAGCAGCAGGCTGCGCTCTTTATTTTAGTGTG
CGATTTGTTAGGGGTTCCAACCAACGTAATTTCAGCAGGTCGATGTAAGTGAAACGGGTCAAGTAATCTGAAACGGAGGGAGTATTATGCAGATTAACGA
GCTCTCTTCTACTTACTACGCCTACACTTCTGCTGAGCCTGTTTTTTTTCCTTCGGTGGGTATGCCTGTTTGTTGTTGAACGATACCTTAGGTTTCCCAG
CTGGGACGTCTTTTGCCTCGAAGTCGACGAGCTTGCGCACAAATCGACGGCCCTCGAAGCTGCTCAGGGTCCAAGTGCTGCGGTGGCTACCACGTCGGCC
CCCAACTCCACCAGGTACAATAGAGTTCCGTCTTCTTCTCCAATCCTCTCCATTACGCACCTTTTTTGCCAGGTCAGGTATTTGTCGAACGCCGTATTCA
TTGCCCTCGCTGCATCATCGGCTCCTCGGCGGCGGGCCATCAGAGCGGCGAGATCCAAGGCAGCTTGGCGGACGTCAAGTGTAGCCTGGGCAACTTCGGT
TTCGTCCATGGTGGGCCGTCGCAGAGCTTCTCCAAGTCCGTTTCTGGCGTCGGCAGGCGTCTGCAGCGTGCCGGCCTTCTTGCGCAAGGCTTCAACAAGG
TCCGTCCACGCGCACCGCTGTTGCTGCTCATTTTCGGAGGTTGGCATCGCCACGGCACCTAGC