Description :
From Genome Similarity Track
Location :
Scaffold_6:377476- 381860
Sequence
4384 bases(100 bases per row)
ACGGAGAGAAGAGACAGAAATCAGGTCCGACGTCAGATCCAACGTCCAGCCCCGATCCAACGACCACTGAAAATCCGCGGTACAAAGACTCAGAGGCAGA
TGACCAAGTCTGTTACCATGTGAGCGGAGATCTACACGCGGAAGACGTTGAAGCTGAGATGGCCGTATTGCCCGAAGTTACTCCGGCTACAGAGGAGGTG
ACAGTCGAAGACATCCAAGTGGGAGATCCAGATGTTAATACGGCGGAAGAGATTGACCGACTTCGGCGACGGATCTACACCTGCTGATTGGCAAAGGCAA
CGCGCTGCCTCCTGCGGCTCGAGGCATCGTGTGTGACATAGATGTCGGGGATGCTAAACCCATTGCCCAGCGTGTGCGGAAGGTGGCGCCGCAGTATCAT
GAGAAGTTGTCGGATCTGATCAAGGGATTGCTCGGTGCCAAGATCATTAAGGATTCAACTTCCCCGTGGGCATCCCCGATCGTGGTCATCATCAAGAAGA
ATGGAGTGGATATAAGGTTGTGTATTGATTACCGACTGGTTAACAGTCTGACCAGACTGATGGTCTACCCGATGCCCCTGATTAACGACCAACTGGAGGA
TCTGGACAAAGTGCTGTGGTATTGCTCGTTGGACATGGCCAGTGGATTCTGGGTGGTGACTATGACGGATCGGGCTCGTGCGATTTCCGCTTTCATCACC
CCGTTCGGATTGTACGAGTGGAACCGGATGCCCTTCGGATTGAAGAATGCGCCTCAGATATATCAACGGATGCTGGACAACGCGCTGTATGGGTTCACCC
GGATCCCACAGTTGGAAGGTGGATCGGGATCGGACGGCGGATCGAAGGTTACGTGTGGGATTGGATCGAAGTCACTGGATCTGGATCTGAAGTCAGGAGA
GCCTGAGGACCCTGGCAAACCGTCGGTACTTGGACGGCGATCCTACATTGACGACATCTTCGTGACCGCTGGATCCTGGGACCACTTATGCGCCCGGGTG
GACGCTCTGCTGGACGCGTGTGACAAATGGAATCTTTCGATCAGTGTGGTGAAAAGCTTCTGGGGCAAGAGCAAGGTGGAGTATCTGGGCCATCGAGTGT
CCCATGCTGGATTGGAGGCGAATCCTAAGGATCTATCAGCCCTGACGGATCTACCCTTCCCAGGGTCCCTCCGATCCATGCAGTCATTCCTCGGCAGCCT
GAACTATTACAGTCGGTTCCTGGAGGACTATGCGATCTACGCTGCAGTTCTCTATGAGCTACGAGAAGTGGACTTCGCCGCGATGAGTAAGCCGGACAAC
CAAAGCGCATCCAACTCACCATGGGTTTGACGACCTCGGATCCAATAGATCGGCACTCGTCGGATCCATTAGGGCCGAGGACGGTGGATCTACAACTTCG
ATCTACAGAGACTTTCGACCTGGAGGCGAAGGATCCTGTTGGCGTGAGGACTTTGGATCCAGAGGCATGCGACCCAGGCAATGTGGATCTACGCTGGATC
CGAGCTCATCGGGCCTTCGCGACACTGAAGGAGAAGGAAGATGGCGAGGACTCCAATCCTCCGACACTTCAATATGGATCTGCTGCCAGTGGTGGTAGTG
TATGCTAGCGAATGGGCCATTTCGGCCGCTCTGATGAAGGAGTATGACGGGATCCAGTACCCAGTCACCTTTACCAGCCGCACTCTGAAATCGAACGAGC
TCAATTACGACGTCGTCGAAAAGGAGGTGCTAGCCCTGCTGCGGATTCTGGATCTGAGCTACAATATGTTGGTGGGTCGCCAGATCCGGGTCCTGACTAG
GCACTCGACTCTGGCCTGGCTGTTTCGATCCACTGGTCTGCAAGGACGGCTCGGACAGTGGGCCGCACTCCTTTCGCCATATACTCTTGAGATTATGAAG
TGCGCAAAGGGCGAGGACGAGATCCTAGGAACGCTGGCAGCCAGTATCACACCCCGATCCAAGGTGGATCGGGCATTGATCGACATCGCACCTAAGAAGG
AGCCGCGACGCAATGTCCAAGCTCCGATCCCGACAGTACAACCTGGTGAAGAACTCTATGTGGTCAGCTTTGATGGATCAGCGCGTGTCAAGCGAGGAGG
AGGCGCCTACAGTGCGAACCTTTGGAAACTGCCAGAGTGGAACGTGGTGAAGGCTAGATCCGGGTATGCCGAAGGTCTCTCCGTCAATGAAGCAGAGTAT
CACGGACTTCTGCTATGCTTGGATCTACTCGAAGGCGAGGCACAGTGACGACTTGTGATCTGTGGTGACTTCAATCTGGTGGTCCGCCAGGTCCGAGGTG
AGATCGACTGCATGGCACCTGGATTGACGCTGTTGAGGCAGAAGGCGCTGGATCGACTACGTGTCTGGCCCAACCACGAGCTGGTGCATGTCAAGCGCGA
CTGGAACGGTAGTGCCGACACTCTCGCTAGCGCGGCACTCCAACGTCAAGCCGGAATCATGGTGGAGGGTGAAGCGGACATGCAGGATCTAGTCACCTTG
AACCGCCTGGATGAGATCCTGGTGGTGAAGACCGAAGAGGATGCGTCGCTCGGGTGTCGCCCGTAACAACCCGAGCTGGTGCAAGATCCCGATCCAACTC
CCGACCTACATCCAATTCACAGGTCCTACAGGAAGAAGTGGTGAGAGACCTCCGGATCGCTAGGATCCGCCAAGCGCAGGACGAGGAGGCGTGGGTCTCC
GGCTTGAAGAAGTATCTGGCGGGCGACATTCAAGGTCTGACGCAGGAGGAAGCCCGATCCTACGGTACTATTGCGATGGATTACGAAATGGATCGGAACG
ACCTGCTCTTCTACTGCCCTCCGACGAAGAAGGTGGAGGCGGATCGCGATGGATTGATGAGGTTGGTGCTTCCAGAGACGCTGCAGCGAGATGTCCTTCA
TCACTACCATGTCAGTCTGGAAGGAGGCCACGAAGGGATCGGCCGTACCTACCAGCGGATCCGAGATCACTTCCACTGGAGAGGCTTGTATCGGAGTGTC
CAGCAATATGTCGGAGAGTGTGTGGATTGCGAAACCGGCAAGGGGCGGCCCACGATCCAAGGCGAGTCGCCTGGCAACATCCAAGCCACATACCCGTTCC
AGATGATAGCGATGGATCACATACCGTCGCTGCCCAGATCCAACAAAGGTAATACCGTCTGTTGATTTGGGTGGATCTGTTTACCGGATACGTGATTGCG
AAAGCCAGTGACTCTCGAACCGCGCAGACTATTGCGGAATCCTACGAGGAGTGTGTCTTCAGGAGATTTGGTGCCAGTGAGGTGATCCGACACGACCGTG
AGCCGGGGTTCATGGCTGACTTCTTTCGATCCTTCAACCGGATCCTAGGTCAGCGACAACGCGCAACAATGGCGTATCGGCCGCAGGCGAACGGAACAGC
AGAACGCATGGTACAGACCGCCCCCGGGCTCTCAAAATGCATGTGCAGGATCTGGATCAACGCGATTGGGACGATTACGCGGAGCGACTCACCTTCGCAC
TCAACACCGCACAGGATCGGATTCGCGGAGAAACACCTTCTACTTAGTGCATGGATGGGATCCTAGATCCACCCTCGAAGCGACGATCCCGGTGGGCAGC
ACTCGCCGTCAGGATCGAGATCCGAGGAGATGGCGGTACCAGATCCAGCGCTACTACCAACAGGCGCGAGCAGAGGTCAGCACACGATTGCAGGAGGCGA
TTGCGGATCGAGCGGATCGGCATAACGAGGAGATCCATCCACATCAGATTGAGACTGGATCCCGCGTCTGGCTATTCTTGGATCGGGTCAAGGAAGGATA
TGCTCGTAAGTTGGCGCACCTGTGGCACGGGCCATTCCGTGTTGCGGAGAAGATCGGTGAATATGCGGTGCGGATCGAGACTCCTGGAACCGAATACAGG
CTGTTCCCCGTGGTACACGTGTCCAAGCTGAAGTTGGTTCGAAGTTTTCCGGATCGTCCTCGGATCCAGCTAACTGAAGGCACTACAGATCGGTACGACT
TTGATGAGGCGCTGTTGCCCGAGGACAGTTGGATCCAGGATCTGGAGGAAGATGAATACGAAGTGGACCAGATTACGGACATGAGAACAGGGAGACGGAC
TCGTTACGGACGGATCCATCGCGAATTCCTGGTGCACTGGCGTGGATACGAGGAGCCATCTTGGGTAGACGAGGCGGATCTCAACTGCGGTGCTATACTG
CACGAGTTCCTGCGGAATCGCACTAACCGGAACCGGTTTGGTGTGATGCAGTCTCATGGGGAGTAGTGGGGCTGCGACCCACTAGAGCGAGCTGGTCGCT
CTATGGAGGAACTGAGATGATGGATCTGCAAGGTGGTTGCAGATTGGTGGATTGGGACTTTGTGTATATGCATGTATGGATCGG