Description :
From Genome Similarity Track
Location :
Scaffold_81:37747- 42689
Transcript NameFunction/comments
Hyaar_Emoy2808456hypothetical protein

Sequence
4942 bases(100 bases per row)
GAAGACTCCCTATTGAGATTGTTCGTGGAACTAGACGATGCCATAAAGGCTCGTCATATCGTCGATGAGGAAATGCAGATCGCATTTGCTCAATCGAACT
TGGCAGGGCGTGCAAAGACGTGGGCCTTGGGCCTTAAGTTCCACGACCCATATGTCTTTGGGTCGTTGGAAGTCTTCAAGTCCCTGCTGAGGCAAACTTT
TGAGCCTCCGCGAGCTGAGTTCAGGGCTCGCTCTGAACTCCTGAGGATTAAGCAAGGTAAACGTGACGTACACTCGTACATACGTCACCTTACCAGTTGC
ATAACAGTCGACCCACTGAACCAACAAAAGTTGATTACGTTGTTCATGCAGGGTCTGACTGATGGTCCTGTTAAAACCTACCTTTTCCGATTGGAGTTCA
ACACCCTCGAAGAGGCAATAAGGGTTGCGGAACAGGAGGACTTCAGCGTGAAACAGGCTCACGCGAATTCGAATTCCTATCGTCCATCGAGACGACAGGA
AAATGGAGGCCCAGAACCAATGGACCTCTGTAACACGAGGAGCGAGAGCTCTCGTGATAACAACTATAAGAAATTGCAGAAATGCAATAGATGTCAGAAG
ACAGGGCATTACGCATATGAATGCAGTGCCCCGAGCGCGGTACCACGTACCGCAGGGAACAGTAACCGCCAAGCGGCCAAGAGAGGTCCAAGGCGTGAGT
CCGACGTTGTTTCGAAAACGCAACAACGTAACGGACAGCCAAAAAACGGTCAGGGTTAGTAGGTGCGGAGCAACCTACTGATCCAGCAACGTCAAGTGAG
TTTGCAGGCCTCTTGACGAAAGTTGCTCCCAACACTCAGTCATTGTGTGTTGCTGCTTCTGGTAATGAGGTTTCCCTCATTACCTTGAAACTCGAAGTGA
CACAGAACATGTCGCTTCTAGCCCTAGTCGAGCGTGGGGCGTCGAACAACTTTGTACGACGCCAATCGCTAGACAACAGAGAGCTCGAATATATCGAGCG
CAAGATCCCTCCAACGAGGATGACGGCGCGCCTCGCGCAGGCGCATCCGTAACAGTGATGAAACGTGTAGTGGGTATTACCTATACACTGAAAGAAGTCC
AATAAGATGATGACTTCATCGTCTTGGACTTGTATGACAAATTTGATGTTATCCTTGGACTGCCGTGGCTCAGAAGGTACGATCCACAAGTCAGCTGGCA
TCGACGAACAGTCGATGTGCCTGTCACTTGTTCATCATATGGCCATCTGATGAACGCCATGGAGCACCCACTAACATGTGGGTGTAATACGAGCGAGTGC
GATGGCCTCGCGTGTGGTTCGGTCGTTAGTACGACTGCACATGGCCATGGAGTGACTGATCACCACACCATGAAGCCAGATTCCGGCGACTGCAATGAGA
TGCAGGTCGCGCCGAAGGCCCACCACCCGAATAAGTCGAGTGGACTGGGGCATGAGTGTCCTCCAAACGGTCACATCCCAAGTGACAACGAACCGATTGC
CGATGATTGGCAATACGGTGATCTTAGTGCGATTGGAGAATCGCACGTAGAAGACCTGGCCACGGTAGCGCAACCACCGCCAGAGGACAGCGAGGGAGCA
ATTCCACTCGTGTCATATGATGATATAGCCCAAGAGGATAGTGAGGGAATAAGTCCCCAGCCAACTGTGGAAATAAGTTCCCAGGAGACAACAGACATTA
AATGTCCTGGTCAATGACGGATCAAGTATAGGCACTTACAAACTTGATCTGATCGCGCCTCCGAAGACAACTTCGGAGATCACTCAATTGCACACGCTCG
AACAGAAGAGGTTCTTGCGTGATCTGCGTAGTGGCAAAGTCAAGCAGATTTGCGTACTCGTCGCGGAAGACGAGTACGTAACCGATATTCGGTCGGCAAT
GCTATTCGCTGAGAACGAAAGGGTTCTCATCAGCTCATCAATCGACGAGAGTTCCCTTGATATGAAGACTCGGATTGAGCGATATGCATCCCAATCGTGG
GTATCGCTCAAGACAAATTCTCTCTACGATAATTTGACAGAATTCAGGGATGTGTTCCCAGAAACAGTGCCGTGCGAGCTACCCAAGGATAAGGGTACTC
GTCACGAGATCTACCTGAAACCAGTTCAAAGTACTGTGTCATGAAGCAATGGCCATTGCCTCGTGAACAAGTACTAGCGATTGACAAATTCTTTGCCGAT
CGCTAGGCAGCGGGCCATGTGAGGGAATCTACTTCCCCACATAGCTCTCCGACCTTCTGTGTCCGAAAGGCCACATGAGGATGGCGGATAGTACATGCCT
TCAACAAGTTGAATGCTGCCACTGTACCGGCTCAAACGCCGATACCAAGAAAGGATGTCATTATAGATGGTATGGCTACGAGTACCATATTTTCATCGAT
GGATCTGATGGACGGGTTCTATCATATCCTTATGCGTGAAAGGGACATTCCTTATACATCAGTGAGCACCCCAAGCGGTATTCTTTGGGAGTGGTTAGTA
ATGCCACAAGGGCTGAGTAATGCCCCTGCTACGTTCAACAGACGCGTTACGAATCTGTTGAGATCTATGCGAGAATTTGAACCTAGGTATTTCGATGACG
TGTTCGTCCATAGCCGGGCTATGGATGGACAGACGGATTTGGAAGTCCACCGACTCCACGTCCGAAAGGTTCTTACACTGATGCGCGAGCATAAGTTGCC
AACCTCAAGAAGTGCATATTTGCTGCAAGCGAAATACTAATTCTTGGATTTATCGTGGGTAAGCACGGCGTCCGGCCCGATCCGGAAAAGATCAAGGCGA
TCACTGACTGGCCGGTGCCTACCGACATAAAAGGACTTCGAAAGTTCCTTAGTCTAGCGGCGTATTTGCACAAATACTCGCACAATTACGCCGAGATGAC
TGTTCATCTCTCTCGTCTATTGAAAAAGAACGAGAAGTGGGCATGGAGTGCTGATTACCAGCGCTCTTTCGAAGGTATCAAGCAAAGCTTGATATGCTCG
CCAGTTTTGGCGATTGCAGACCAAGACAGACCATTTCATGTGGTCTGCGATGCAAGTGATTTTGCCATCGGATGTGCACTAATGCAGTATGACACAGACG
GTTCTGAGCGTGTCGTCTGCTATCAGTCATGTCACCTGCACCCGGCTGAACGTAACTACCCAGTCTATGACAAGGAACACCTTGCCTCGAAGTACGCTTT
GGCGAAATTTAGGGTCTACCTGCTAGGTGATAGACCCTTCATCGTTTACACAGACCATGCGTCCTTACGCACGGCTGTTAACAGTTCACACCTCTCGCAG
CGAATGGCGAGGTGGTCGTTCTTCGCGGAGTATAACGTCTCCGTGGAATATGAGCCAGGACGACTGAATGTCGTCGCTGATGCTCTGTCGCACCGGCCCG
ATTTCGAATCGGCTGCGCAACCCGACACTGGTCCGACCACTGTTGCAGTGTTGACGTCGAGTGTCCCGTCGTCAACCTTATTCGAAGACATACGAAAGGC
GTACGATCCGGCGATGGTGCGTTTGATGCATCATCTCTTGCAACCATCCCGTCAATCCCTAAAAGGGTTGCCCCCAGTATATCGATCTTCCACGGATCGA
TATACAGTCCACAATGGCTTACTGAAGTATTCAGCTGTTTCCGGCGACACGCCTCGTGTCGTCGTACCGGACCATGGTGACCTGCGACTGCGCATCATGT
ATGAGTACCACGATGCACCTACTGGTGGGCATCGTGGTCGAGAGAAGATATATCTCACAGTTAGTCGCGACTTTTACTGGCCTCGCCAGTATCATTTCGT
GCGTAAGTACGTCCGCGCATGCGAAGTATGTCAACGGGTGAAGTCTAGTCCTTCACTTCGTGCGCCGTTGCAACCCTTGCTCATTCCGGCAGAATGCTGG
GAATCAGTCTCAATGGACTTTGTCTTTGGATTCCTCGTAGACCCACACAAGAATACAGGTATTCTTTTGTTCGTTGATAGATTCAGTAAAATGGCACACC
TCGTCGCTGTACCTGAATCTATCAATGCATCGGCATGTGCTCGTATTTTTATTGACACGATCTTTCGTCCTTATGGGTTGCCTCGTGAACTCGTCTCCAA
TCGAGATCCACGGTTCACTGCTAATTCTGGCGATCCGTGTTCAAAACACTCGGAACGCGCCTTCAGATGTCGACCTCTGACCACCCTGAAACAGATGGTC
GTCAGAATGTGCCAACCGCGTTTATGAGGAAATCCTTCGGGCTTACGTCCATTCGTTACTAATTGGAGCGAATTCTTGCCAATGGTGGAATTCGCCATCA
ACAACTCGGTGCATGCATTGACGGCGCATACACCGTTCTTCGTGAATGGCTTGCGCCACCCACGCCTACCCACCATTTTAGAGTGTAACTCTAGTTTGAG
AGGGGGGGATCATTCGAGCGAACGCCAACTCGGCTCTCACTCATCGCATACTGACCACGAGGTCACTACGTATGACGCCGATGTCGATCACATCGACTTC
GGTGAAGAAGAGGAAAGTAAGAGCGAGGGTGCTCTTACTACCCAGGTCACTGATCTTGCCGCAGTGCGCTCCAAGCGCAATATAGCCTAAGACAGCGAGT
CAGCAGATGGATTCATACTGGCTCGCGAAACGGTTGTCTGTTTCGTGCAAGATTCCATTGCAGAAGTGGTGGACCGACCACAGAAAAAAGCTGACTAGAA
TGGAAGATCAAACGTTCTTTCATTCAATGAAGGTGACCTAGGTCTACTACTACGGTAAACCTACCTTGACTCATAGTGACTAACGTGGGAAGTAACAAGT
TACTACCCAAGTTCATCGGTCCATGTCGTGTGCTGCGCCACTTAGGCAACGCATACACGATTGAACTGACACGTAAGATGCGCACGCATCCTACGTTCTA
CGTCGGTCGTCTTGGGCCTTATCACCAGTACGGGACTTCTAC