Description :
From Genome Similarity Track
Location :
Scaffold_190:37744- 40712
Sequence
2968 bases(100 bases per row)
CCTTGGGTAGCGGTTCTTTGCACCAGGAGGTTAGTATCGACCCCGTGAATCAGACAGCTACGCCGGGCTAACGCTAGAACAATCCAACCCAAATAGAGTT
ATACACGTTATACAATCACACAAATACTCCTTTGCCCTCTCTTCTTTCTCTAGGCCCAAGGCTAAGGCCAAAACACAAGTCAACTGGTCCAAATCCAAGA
CACTTGATCAATCTTGGGGACGCGCACCACCTCTCGGAGAGAGGAAACAATCTACCCTGTCGCCAACTTCTTCAGTTCGACACAAGCCCAATAGACCGCA
AATATACAGCAAAGACGGTCTGCAATCCGCCAAATATACAGATATGGAATATATATGATCACCTCCAGGCCGAAGCAGTGGATCACTTACCTAAAGTACT
TTGAATTTTGTCGTGGAGAACGGCCTTCCAGGCTGTGAAAGAAGCACTCGTGCCCTTCGAAGCAAAACGAACTCTGTTTGGTTAAAGGTCACATGCAGAC
GAAATCTTTCCTAAGCGACTCCTCGGAGACTGCGATTTTTCGGCGGAGTGTTGGTCTGACCGTGAAGGGTCGCCAGACTGGATACCTTCTCGGAGTTGTT
GGGTACACCTCGGATCTTGGAAGATGCCATAGTGAAACCAAGTGTTCTTGGGTTTGGAGCCTTGAAACGCCTCGCACAGAGGCTGCTCTTGGACTTTTGT
GGGAAGTAAGTCTGAGGACACGAACGTTGGGAGTCGTTATTCTGGGAAAACAACGGGGAATCTGAGAAGTGCCTCAGCTCCCAGGTTGTAAGCCAGAGTC
GAGTTCCGCCTCGCGCAGATTCGTAGGGAAGGTCGCACACATTCCTGTGCACTTCTAGGAACGGGATCCATTCGCCTACACCGACCTGCTTTCCGGGGTC
TCACTTTCGCCACAAACATACTCTTGTTTTTATTCGGCTCCAAGTCCAGCACGAACTCTCAGAATCCCAGGCACGATTGTCGGGTTCCAAGAATGTACCA
CTTATCTGGTACCGTGGTCATCATTCTTGACCAACATATTTCCACCAATCCGCGAACTCCACAATCTGGGCAATTCCCGGGTTTTGGTCCCATGACCCAA
ATTTTAGTGACGGCACCGCGTAACAAATCTACATTGACGAGAAGTGGTTTTACATGACCGAAGCCGACAGAACGATCTGCATGGCATCCAACGAGACACC
GCCGCACCGAACTGTCCAGTCAAAACGCTTCACCACGAAGGTTATGTTCATGGCTGCTGTGATGCAGCCTATCTACGGTGCTGACGGGTCCATGGTCTTT
GACGGGAAGATCGTCATGTGGCCCTTCGTGGAGCGCGTTTCAGCTCTGAAGAGCTCTCGAAACAGAGCTGCGGGTACGCTGGTGACCCGTTCTGTCAACG
TCGGACGCAAGGAGCAGATAGCGATGCTGATTGATAACGTCATTCCCGCCATCAAGTCGAAGTGCCCTCCTACGCTCCGCGGTACTGAACTCATCATTCA
GCAAGTAGGAACTCGCTGTCATGTCAGCCCCCACGACCCATTGATTCATGCAGCATGCCAGGAAGGTGTTTGGAAGATCACTCTCGATGTACAGCCGCCC
AACAGCCCCGACCTCAATACGCTTGATTTGGGGTACTTCTGCTCGATTCAAGCGCTTCAGTACGAGGAGTGTCCACGCAATATCGACGAGCTGATTGCCT
GTACGGTCGCGTCGTTGGCGAACCGGAAAAATAGCGCACGTGAAGATACTTTTGTGTCACTGCAGAAGGTTATGGAGTGCATCATCCAAGACCACGGAAA
CAACAGCTACAAGCGACCTCACATTGGGAAGGCCAAGCTTCGTAAAGCCGGACTTCTCGGAAGAAACTATGTGTGCGATTCGTCCGTGTACTTGGAGGGT
GCTGCCTATCATTTTCTAGCAAGTCACGATAGAGCTGAGAAGGAAAAAAAAAACTGCTGAGGTTGCAGGTAGAGGCTTTCAAGATTTTAACACCACAAGA
ATAAATGCGTGTTATGTTGATACAAAGTGGGCTTTGGGCACGTAGCTCAATTGGTTAAGAGCACCGCCATTTGTGCGGAAGGGCGCGGGTTCGATTCCCG
CCGTGTCCTTAATTTTTTAATAATTAAAAACTAGGATTTACCGAGAAGAAAGCCCTAGTCGCGATTATAATGCACAGACGTCTATTCTCACTTGATTATT
GTATGGACCAACGACGTTCTGGACGCTGCAAAGGAGGAGAAATGCCGTAAATCTGCATGATTATCACGCCATGAAGCAGCAGGCTGCGCTCTTTATTTTA
GTGTGCGATTTGTTAGGGGTTCCAACCAACGTAATTTCAGCAGGTCGATGTAAGTGAAACGGGTCAAGTAATCTGAAACGGAGGGAGTATTATGCAGATT
AACGAGCTCTCTTCTACTTACTACGCCTACACTTCTGCTGAGCCTGTTTTTTTTCCTTCGGTGGGTATGCCTGTTTGTTGTTGAACGATACCTTAGGTTT
CCCAGCTGGGACGTCTTTTGCCTCGAAGTCGACGAGCTTGCGCACAAATCGACGGCCCTCGAAGCTGCTCAGGGTCCAAGTGCTGCGGTGGCTACCACGT
CGGCCCCCAACTCCACCAGGTACAATAGAGTTCCGTCTTCTTCTCCAATCCTCTCCATTACGCACCTTTTTTGCCAGGTCAGGTATTTGTCGAACGCCGT
ATTCATTGCCCTCGCTGCATCATCGGCTCCTCGGCGGCGGGCCATCAGAGCGGCGAGATCCAAGGCAGCTTGGCGGACGTCAAGTGTAGCCTGGGCAACT
TCGGTTTCGTCCATGGTGGGCCGTCGCAGAGCTTCTCCAAGTCCGTTTCTGGCGTCGGCAGGCGTCTGCAGCGTGCCGGCCTTCTTGCGCAAGGCTTCAA
CAAGGTCCGTCCACGCGCACCGCTGTTGCTGCTCATTTTCGGAGGTTGGCATCGCCACGGCACCTAGC