Description :
From Genome Similarity Track
Location :
Scaffold_438:3774- 6854
Sequence
3080 bases(100 bases per row)
CTTCCTCTGACTTAAGGAGCTGTGCAGCTCCGCTACACTTGGTAGCACTTGTATTCAATCTACGCCTGAGTCTTTAAATACTGATCCTCTGTGAGGATGG
AAAACCCCACTCCCCTCTCTGAGGCCCAAAAGGTCGCGCTTGATAAGCTGACCGCATCTTTGGGTCCAGATTACGTGAAATTCCTTGTATCGCAAGGCCC
AGAGGTCCTTACTGCACGTTCTGAGGGCTTCTTGCAGTATGAAGCGTCCCTTCTAGGACAGGTCCAAGACCAAATGGCGTCGGCTATGCCTACACCCTAT
GTGTCTGTTCCAGACGAAGATGCTAGGATTCGTCCACTGAGAGTGGAAGTTAAAAAATACTCAGGAAAGAAGGGTGAAAACCTCATCCTCTGGATCCGTG
AGATTGAGATGGCCATGAGATCAGGCCTGATCAAGCTTGACCATCAACAGGTCTCGCTGGCTATCTCAAAGCTCAATGGAAGAGCTAGAGAACGGGCCTT
GACGTGTAGCACGTCGGTCGACTTAGCGTTTCCCACATGGGAGTCGCTTAAGTCACAATTGATACAGGTGCTTTCACCACCTAACCAGGCTTACCGCGTG
CGTTCACGCTTTTTATCAACCCGTCAGGGTAAGAATGAGTTAACGGACTATGTCCAAGAGTTGAAACCTCTCATGGCTGCTATGCAGTCTGACCCTCTGC
CTGAGGCAGTCCATGTGACTATATTCATGGAGGGTCTCCGTACTAGCATTGCCAGAACGGAAGTATTTCGGTTCTGGCAATGGAAGTCTTTCGGGTTCAC
CCCTCTACATTTGAAGAGGCTATGCAAACTGCTCTTAATGCTGAGCATAACTTCAAGTCAGCCAAACTTGGCTAGAATGGGTACAACTCTAGCTCTGCGA
GAGAAAACTACACGAGTATTCCGGCCGGTAATAGGCCGGAACCGATGAATCTCAGCTATGCTGAAGATGAAGGTGAAGTTGAACTTCAAGCTGCTGAGCA
GCAACGTGTTGTACGACGGTGTTATACGTGCGGAAGTACTAAACACTTACGGAATGGTTGCCCTTTACGTAGACAGCGCCAGGCTACGAGTCAACACTCT
ACCCTGAGCCAGAAGTCTGGCATGGCACGGGGAAATGCCGATACCTAGTAGGCGAGGGGCTCCCTACTGGGGAAGAACTAGGTTCTGTAACACCTTAGGA
GGTAAGGTTGAACAGGGCTTAGCCCCAAAGAGTTCCGTACCTATTGGTATGGAGCATGGATAAAAGGCTGGCTTGTTGGTCGCTGAGACGAAAGTTAAAG
GCTTTGAAAAGCCTTGGTCGATTTTTTAATCGATTCTGGAGCATCTGCCATTATGGTTGACGTCGTTCCCTTGAGAGAAGTCAGCTGTATGCTGAAGCGC
TTACAGCGCATGAGGGTGATTCCATCACGGTTCGTTTAGCGACTGGAAGTCGTGTCACTGTACCTAAAGTTCCTTTCAACTTAGGTATAAAGTTTTTAGA
CTTTGATAGCATTGAACGCTGTCTTGTCCTTGATTTGGACTCGAGATATGATCTCATCCTAGGTATGGCTTGGCTTGAACGCCCTGAGCCATGGATTGAT
TGGAGGTCGAAGACCTTAGGCGCTACGCGCAACGTTCCTAGCGAAGTTTTGGAGAACCCGCCTTTGCTAGGCAACAAAAGCACTATTGGCGCGAGCCTTT
GACAGAAGACGTCAATGTGCTGGACATTGGAATGTCTGAGTTAACTAACTCCAATGTTGAAAACATGAATTCCGAGCGTAGCTCGTTGAGTATTAGTGAT
ACGGCACGTACTCCGTTGAGTGTTACTCGTTGTGATAACGAGTCACTGCATGCTGAAAGCATGGTTGGCCTAGGGCCGAGTTATCAATGATGTGATTTCT
TTGATGTGTGTGTGGTGGCACGTGAAAATGCACCTAGTGCGGTCGGCCGTGAAGGCACCACACTTAATATCGGTAATGACATTGTTGGCGAAACGCCATT
AAGTTCAGGGCTAGGCCCGTATAATGTAAGTGGAGTGGCACTTTTAAATCTACTGGGTGAAGTGTTCGAGTTACGTAACACTTCATCGGATGTCGATCAA
GACATCAGCTCTCGTATAGAGCGTACTACTACTACTAGTAACCACGGGGACACTATTGTCCCGACCCCAGAGGGGTGTAAGGTCTCATCGAAGAGACGAC
CGGGACGCCAGGTGGCAACTGTTAAGCTCCAGGCGTCCGTGCAGTCACATAGTGACAATAGTGATACACTATATACACTTGTTAACGGAGTGACTGGCCA
GGTTGAGGGCAATGTTAGCCTGGAAACCCTTCCATATTTGTGAGCTAGACGAAATGTCTGATGGCGAGTTTAGCCAGGCCTTGAAGGCAGGAGATTTATC
CGAATTAGTGGTCATTAGACTCGATGTCGAGTTGAACTCGTCCTCACTAATGGATGAGTCGGTCCTAGAGGATACCAAGGCGGCACTCAGTGCCCGGAGT
GGATCTTCGATCCTTAAAGATCTTTTGGATCCATTCTATCTTTTGGTAAAGGGATTTCAAGATGTGGTGTGTCACAATCCACCATATGTCTTACCTCCTG
ATCGAGGTGTACGTCATAAAATTGACCTAGTTTCAGGAACTAAATACTGTGTAACACGGCAGTGTCCTTTACCTAATTAACAGTGTGATGTCATTGACGA
TTTCTTTCGTGCTAAGCACGCGGCGGGAATGGTGCGGGAGAGTAAGTCTCCCTATTCCACACCTACATTTTGTGTCAAAAAGTCTAATGGTAGTGGCTTA
TTGTGCACGCTTATAATAAGCTCGATGTTGCCACTATCCCGGCTCAGACACGAATCCCTAGAAAGGATGTTCTTCAGAACAATATGGTGGGATGTACATT
GTACAGTGTGCTCGACTTAGTCGATGGTTATTACCAGCTTCTCATGCGAGCAAGCGATATTCTGCTAACAGCGGTTAGTACCCCGAGCAGTATGCTCTGG
GAGTGGCTCGTTATACCACAAGGGCTGTCAAATGCCCCGGCTATTTTTAATCGTCTGGTGACGCAACTATTTAGACCTTT