Description :
From Genome Similarity Track
Location :
Scaffold_492:3773- 5308
Sequence
1535 bases(100 bases per row)
CATCCTTCTTCTTCACGCGCTGCACCTTCAGGTGCCACTGCGATAGCAGCACTGCGAACTGGACCGCGCGTCCGAAGAGAGACTTTGACTTATGCACCCA
CTCTAACGTCGAGAATCGTGTATAGACATGTAGCGTCTTTCCTGCCAGCTGGACGTAACAGATCTTCAACAGCAGAAGTAACGCCAACACTTCCTTCTCA
GCAGGATGGTAGTTCATCTCGGCCTCCTTGAGCACCCAACCGAGGAACCGCACGGGGTGTAGCTTGCCTTCATGTTCTTGCATTAGCGTAGTGCTCAACG
CTTATTAATTCGCAAAGAGCATGACGTGATCTGCTTTCGACCGATCTAAGTGCCTGAGGATGGGTGAATGTGAAACACTCGTCTTCAATTTTTCGAAGGA
ACAACGTGCCACAGAAAGGCCACCTTCAACGGCAAAGTCCTCATCCTTGAGCTGGTACAGCGCCGCACCGTAGACCGCGAAGTCTTGAATGAAGCGGCTG
TAGTAATGAACCGCTCCAAGAAACGACTGTATGCCTTTCTTACTCGTTGGAAACGAAAGCTCGGTGATGGCCGCAAGCTTCTTGGGGTCAGCCCTGATAC
CTTCTGGCGAAATTGTATGCGACAGAAAGTCCACCTTGGGTTGGCAGAAGATGCTCTTGGTGAAGTTAATGCTGATCCGACACTGTGCAAATCTTGCCAG
CAATCGGTCCAGTGTCGCCAGGCAGCTGTCGAAATCCTCGCCACCGAAGCAAATATCATCCACAAACGACCGTCGACCAAACCCAGGTACCAGCGATGAT
TCGTCCGGTTCCCCGTTCGTAAACATGTCAGCGACGGGGCTGTTGACGAGTTGTAGTACAGGGTCGGCCTCCACCGGTGCTTCGCGGTCTGCCGCGAACT
TCGTTTGAAACGAACCCTCGGCGCTTGGCCCACGACGTTCCTTGGCCTGTTCTTCATCTAAACGCATTTTCTCCGAGTATTCAAACCAGCCTCCTTTAGG
TGGAACGAACCCCCAGAGTGCGTTGTCAACCTTACGCTGGTAGATCATCGGCGCGTTCTTTAACCCGAAGGGCATGCGTAACCACTCGAAATGTCCGAGT
GCGCAGACGAACGCCGATACTTTACGTGCCCGCAAGGTCATCATGACCGCAGGTAGCGCTCGAGATCTGTTAACAGGTCGTCGACTAGCGACATTGCCTA
CTCCATGATCGCGGTGATAGCATTCACCATCTTGTAATCAATGCAGAGCCGGATGTCCAGCCCGTTCTTTTTCATCACAATCACGATCGGCGATGCCCAT
GGACTGTCTGAAAAGACGATCAGTCCTGCTCGCAACAGAGCGCGCTCAGCTCGTACAGTTTGCCGAGAAATCGTAGCGGCACGCGCCGGGCACGCTGTTT
AATTGGGGCTTGCCCCTGTGTGTCGATATCGCATACCGCGCCGTAGGCTGGCGGTGGTAGTGCGTTACCACTAGCAATCAGGATGTGCTCGTGGTTCTTT
AGTGTTGCGACCAGACGTTCTCGGCGATCGGTCGA