Description :
From Genome Similarity Track
Location :
Scaffold_21:37727- 40000
Transcript NameFunction/comments
Hyaar_Emoy2803544RING finger ubiquitin ligase, putative
Hyaar_Emoy2803545hypothetical protein

Sequence
2273 bases(100 bases per row)
GTGATACGCGTGCTTGCACGGGAGCGCCACAAGACCCTGTGGACCAGCACTGTGGACCTCTTTCTCCACGACGTCAAGACAGATCATGCACTTGATTTCC
TCCTGGTTGACCACTGCGGTCTTCTCTTCTGCATCGAGCTCCATCTGAGCCAAGTTTGGCGTCGTGGCAGACTTGACCATCGAAGTTTTCGTAGCTGCAG
CCTCGAGTGACGACAGCGATGAATGACTTGACGACTTCTTCATGCCACTCTGGTGGTTGTCTACATACACCTGCAGCAGAGACCGCTTGTCTGCATCGTC
TTCAACGCCCAGGAACTTGAACAGTGCAGGAGGGAGCTGCTGACGGGCGTGAAAGCACTTCATCGTGCTGCCTGGAAGCAGCACCGATCGCAGCAAGTGG
ATCAGCACGTTCTTGAACTTGTTCTTGCGGTCCTCGACCATGAACGACCAGGTGGACATGGGACCCACTTTCTTCGGGAAACACGCCTCAATGAGGTCAC
GAAGGGACTGACAGGACCCTTGACACCTTCCATCGTGGCACGTCCACAGCTCTTCCACTTGGTTACGAAATGCCAGGAACTCCGAGTACCGGAACGAGGC
CTGGCACCGGTTCTGTGTCGACAAGCTCGATGTCGTGATGGTATACACGGCATAGCCTTCCTCTTTCTTCGTGGCGCTCACACTCAGACGAAGTGGCAAC
TCGCTACCAGTGCACTGCCGCAGCTCTTTCAGCGTGTAAATCTTCGACGCCGGGCGTTTCGGTGCTTGAGTGGTCGGTGGGTGGTCAGGTACAACGTATC
CGTTCATAATGGTTGAAGTGATGGAGTCAAAGGTGAATGGTGTAGATCGGTTGTTACTATCGACCTGAGCTCTCGGTGGTAAATTCCCAAATGACATTCG
AGGGGGACCGCGCGTCTCTGCGAATTCGGATGGCTACTTTGTGCATGCTCTTTTTTTGTCCACAGAGGGTGACAGACAAGGACGTTGGTAAACATGAGAC
AGGAGTTTGACTGTCTGCGACATGTGTGACGCGCGTGACGCACCTGCTCGAGACTCCTCGTCCAACTTGGTACAAGGAAATTGATTGGACCGTGGAGACG
CGTCACACCCTTTCGTGCTTAGGCGACGCCAGCAAAGAGCTGTCTAGCAAGAAGTTTGCAACAGACGCACGCCGTGCGAACGTGGTAGAGTAGAGCCAGC
CACCTTGACGACTTCATCCCCAAAACCTCGATCCTTTTTCTTCCATACCACGTACCTTAAACCGCTGTGGTTTTTCTTGTCAAGGGGATGAAGTCGTGCT
CGTATAGCTTTCTCTGATCCTTGTCAATTGACGAGTTAATACACGCACTAGTTGGGGTTGAATACTCTAAGATCGGGTGCTTAGATAGTGATGGAAGTGA
GACGGTGTTGGGTTCATTGACACCTTGAGCCTAAACGAGTCAATAGTGGCGAGAACGTATCTTGGATCGGGTCAAGTCCCGCTGTTTGTTGGATACGTTT
TCTTACGTGCGTCAGAAGACGCGACGGCGACCGATGGATGGCGATGGGAACGCAGACGAATCTTGAGGGAGTCTGTCGTCACGGATCCAGCTGTCGTCGT
CGTTGTCGGGTTTGCGACAAACGCCCTCGTGCGATGGTCATCAGGAGTGACTCGTGGTGCCGATCGTATGAACAGACGAAGCTTTGTGGACCAGTGGTCT
GGCCACAAGACGAAAGAAAACGGACAGGATTCCGGATCTCGGTCTGCTTATGACGGGCTCAGCCCCAGCTGTTGAGCTTCCAGAAAACGAGCTGTTTACT
TGACTTGTACGGTATGACGACTTTTTTGTGACGGGACGACGTGCTGCTATATAGCATGATGGCTAGGAAACGCAGACTGGTTGCCCTGGGTACGTTTTCC
CTTTGCAGTTTGCAGGTGATTGCTGTGCCTGGCATGATGAGCTGAACCGCTTGCCCTCTTAAGCATCTTGTCGAAAGGTAGCTGTAAAAGTTGGTACCAA
ACTGTAAAAAAACGACACGGAATAAACCAACAATTATTGTTTGCTTAACCCGATACATCCATCATGCGCTACAAAATGCTACTCGAAACATAAACAACTC
GTATCTGCACAAACACTGACACCACCTTTCGACAATCACGCGCCATCAACTTTTGGCTCCTGCATAGCGCAAGACTCGCCTCGGCGCAAAGCACAGCAAC
AATTCGGTTGAATTCCGTCCTCAGCGCATTCGAGTCCCACACCAATCGATACTCACCACCCATCCAGTCCGCT