Description :
From Genome Similarity Track
Location :
Scaffold_156:37725- 38886
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_15161Avr4-associated TDF-like protein

Sequence
1161 bases(100 bases per row)
CTTACTTGCCCGGGTGGAGGCCGAGCTGGCCCGGCGACGGCTCTCCCGTGACCTCGCCAAAGTACAAGGAAAACGTGGCCTTGAGCTCTTCGATGTTGGC
GCGGTCCTCCATCCACGACTGGAACGCGAGCGAGTTGGCGCGCTGAATGTCCCAGGGCTGCACACCGCTGGCCGGCAGCACGTCTGTGCGCGACGAGAAG
CCACCCATGAGGGTCGACTGGACCTCCTTGGAGACGATCCAGTTGACAAAGAGCTTGGCGGCCGCGGGGTGCGGCGCCTCCTTCAGAATCGCGATGCGCT
GGCCCCACGCGAGGTAGTCGGATGTCGCGTTCGTGCCCGTGATCTCCTTGACCGACGCCGTGGGCGCGGGGGCCGAGCCCGCGATACCGATGGCCTTGCG
CTGCGCAGTGACGGCGAGGTCTGGCGTGTGGGACCCGCGCTTGAACTCGATCTGCTGCGCCGCCATCTTCTTGACCCAGTCCCAGCCGTACTCCTTGACG
TAGCGGTCGTAGACGAACAACGTCGCGTCGTCGTCGTGCGGGTAGGCAGACGCAATGAGGCCCGCGTACTTGGGGTCGGCGAGGTCTTTCGCAGTCGCGG
GCGGCGTGAGGCCCTTGGCCTGCAGCTGCGCCTCGTCGTAAAAGTAGCTGAACGTAAAGACCGCGTGCGAGAGCCACGTGCCGTCGGGGTCCGTGAAGCC
GTCGTAGACGTTGCTAAAACCGTTGGGCTTGTACTGGAGGAGCTTCTCTTGCTTCTTCCAACGCGGGTAGTCGTTGAGCGTCTGGAGCGCGACGACGTCC
GCGACGAGCGTCTTGGTCTCGATCTGGTTGTCAATGCGCGCGTTGTGGTACTTGCTGTAGTCGACGACCATCGTCAAATTGAGATCCGGGTACGCGGCGC
GGAAGGCGTCGGCGACGTAGTCCTGCTGCTGGGCGTGGTCGCCGCCGTGGTACACCACGAGGTTGCCGCCTTCCTTGCGCGCTTCTTCGTAGAGCTCCGC
GAGGGGACCTTGGGTCTCTTCCGCGACAGACGCGAGCGACCCGCAGCCCGCTCGGAGCGATGCGCTGGTCGTCGCGACGACGAGGGCGAGAACCGGAAAG
ACGTGGAGAAGCTTCATGCTTGGGGGCTTGAGAGAAAATCAAACAATGAGGATCCGAGGTG