Description :
From Genome Similarity Track
Location :
Scaffold_195:3772- 19139
Transcript NameFunction/comments
Phyta_totarag5384hypothetical protein PHYSODRAFT_512359
Phyta_totarag5385hypothetical protein PHYSODRAFT_513680
Phyta_totarag5386conserved hypothetical protein
Phyta_totarag5387mediator of RNA polymerase II transcription subunit, putative
Phyta_totarag5388hypothetical protein PHYSODRAFT_354941
Phyta_totarag5389methylosome protein 50, putative
Phyta_totarag5390dual specificity tyrosine-phosphorylation-regulated kinase, putative
Phyta_totarag5391hypothetical protein PHYSODRAFT_354940

Sequence
15367 bases(100 bases per row)
CTTCGacttgatgtagccatgtcaaAGAGCTTAGGATAAATGAGTTCACTCCACTAGCCACGTGGACCATTAAACCTCAGCAATATTTATTCCTGCATAT
AATCAGGAACAACAGGCTGAAACAAATAGAATTTGTATCAGAATAATCCACATTCAAGTATCTATTATAACAAGTTTGTTTAGTGTGGTGAAGTTTTCAT
CCCGATTAGTTCAAACTTGAAACCACCAGCTCTGGAGCACCGAAAAAAGGCAACAAACAtgtcgatgcagtcgctggcCGACGCCGCCTACATGACGTCC
TTCCTGGCGGCCAAGTCGGTGCCCGCCGTGGCCGTGGGCTCCTCCATCGTGTTCGCCATCTCTCCCTGGTGCGCCCCCACTTCATTCCCGACAATTGAGG
CTGCAACTCACTCTTTGTCTCCCTCTTTCCCCAATAACAGGCCCACCGTCGCAACCATCCGCCGTGCACGCAGCACACTACAGTTCTCGTTCGCcccgtt
cttcttctacttcgTGCAGAGCGTCATCTACACTCTGTAtggctggacgacgagcaacCCCGTGGTGGGCGGCACCTCGCTGCTCGGAGCAGCGCTGGGC
TCTTACTACGTTCTGGTCTTCTACAAGTACGCGCGCGACAGGACGCAGGCCACCAGGATGCTGACGTCGGCCATGCTGGtgatcctgctgctggcccaCC
AGGTGGTCACGCGCTCGCCCGAGGAGGCGCAGATGCTCACGGGCATCCCAGCCAACATATTGTCGGTGTTTACGGCCgcctcgccgctgctgcagctcaa
gagcaTCCTGCGACGTAAGGACGCGTCCTGCTTGCCACTGGGCATGTCGGCGATGAACGTCGTGGCTGGCACCATTTGGTCCATCTACGGCATCATGCTG
GGTGACCCACTGGTCATCTGTCCCAACTTGTTCGCGCTCACTATGGGTGCCATCCAAGTGTCGCTTATCTTGCTCTACCCTGGAGGCAAGGGCGGCAGTG
CCGCGGAGCCGAAGGCCAAGTCTTCGCCTCCAACGAAGCCGGCAAAGAAGTCGAGCCCtcgcaacaagaagaaagccGAGCACCCGGAATGAAGTGGATC
TCGACGGAGTGAAGACGAAAACAAGAGCTCAACctgagtgagtgagtgtGGATGCCGCTCTTTTGATGATGCAGTAGCTAGTATTTTGCCAATGATGGAG
GTAATTCGCGAATGTAGTCGACTTCCTACCGCTACGTGGAGCTGCGATGCTGCACGTGTGTTGTTTGTTTATTTTGGGGAGGTCTTGGAGTGTCCTGCCA
CCTTGCTCAATTCATGCTCTGGAGCAGCCCCGCTAGCAATCATGATGGAGCCTAAGGACTTCGTGATCTCCAATGTGGTATGTCCGTGTGCAAACGACAC
GTGAGTCGAGTTCTTGAACTGACGTCGatgtctgcagcgccacggcgAGATCCAGGTTGAAGTGTTCGTTGCAGGCGATGGCCTCAACTACCCGAAGAAG
GGTCAAACTGTAGTAATTCACTACACGGGATACGTAGGTCGGCGTACTATTGTAGTCTACTGTTGGTCGGTGGTTGCTCACCATTTTCGTCGCGTTTGCT
ACTTAGCTTCAGGACGGCAAGAAATTCGATTCATCTCGGGACCGGGAGAAGCCCTTCAAGTTCAAACTTGGCGCTGAACAAGTGATCCCAGGGCTGGATG
AGGGTGTGGAACGGTTGTGTATGAAGGAGCGTGCCAAGCTGTTTGTGCCGGCTGACAAAGCTTACGGACGCAAAGGCTTCCCGGGGCTAGTACCGCCCAA
CACAaacctcatcttcgacaTCGAACTACTCACGTTTCGTTAATATGgtgcgctgctgccaatACATCCTCCGTAAGACCTTAATCGCGTTCTCGAGCTA
CTTAAACGTCCGCAAAAagttccttcttcttccgctcgAACTCCTTCTTGCGCGTCGATTGTGCCTCGCGAGCGTCGAGTTTCGTTTGAATGGTGTGCAG
CTGTGTCATGTGCCGTTCGGCCACCGCTTGCACTTTTTGCTCGTCTTCACGCTGCAATGTCGTGAGCTCCTGATAGAACTGTGCTGTCACAGGCAGCGGC
TTGGAGAACTCATCCCTGATCACTTCTTGCATCCGCTCACGCTGCGCTTTGTTTCCACTCTTCGCGGCACGAATGAACTCGTCTCTCTCCTGGAGTTGCT
TGCTTAGGCGAAGCGTGCCTTGAATCTGTCGCTCGTTGCAGACCTTCCTCCAGTTCAAATGCGCGATTCGCTCTTCCAGTGAGGCGAATGCCGTCGGTga
cggaagctgctgcattcgcGAAGACTCAGGAAGCACGAAAATCGCAAGTGAGCAAGCCTTCTAACCTTTTGTCACTGTGCTCACTactcatcttcgtcct
cgttAAACGTGCCACAGGATCAATAATAAGGTCGAATCATCAACTGTCCTGGAGAATATTTTTGGATGTCTTCTCGTCTTCGAGCAATGTCAAACTCCGC
CCAAGCTCCAAGTCTCGACATGAGGATGCGATGACAGGGATCACTGGCCATCAAGGGTGCTAATAACCCCCGAAAAGCCTGGGATGGGCTTTTCCAGCAC
ATACCACACCATGCCCGGGTCGCTGGTGTCGGCGGAATTTTGAACACGTGAGGCTTGCAACTCACTGTCGCTTGCCATTCTGctcgtgttgttgcttgTA
GGTTGTTCTGTAGCTGGTGGTTGCAAGTCCTGTAGCTGCGACTGCTTCTTACTGTCAACACCACTGCAGATTGTCATGTAGTGTGTTCGTACCCCACGTT
TGTCCTTTGGAAGCCGAAGCTtgaactgctgcttcggAAGGAATCCTGGAATACGCGTAGACTGACGCTCCGCTAACACTGCAATGTGCAGCTTTGTTGC
CGGTAACGCACTACGGCAATAGTCACAACAAACAGAACAATCAGAGTCTGCAAAACATACCATCATTTCATACACTGCATGCAGCAACCACCCTCACCTC
GAAAAATGCTCCATAGAATGCGTGAATAATGCACTCATGAGCTTCTGCGCACACAAGTGCATCAGTTTTTCTCTCGTCATAGTTGATGACGGCGGTGTCA
GCATCTGCAAGACTTCAAGTGACCCGTCTTCCTGGTCGCTCTGCGGCGAAGCTGTAGTAGCAGTAGACATTAACGATCCAGCATCTTCTACCTCGACGTC
CACATCGTCAAAGTCCACAATGACAGCCTCCCGCGGGCTCATCATCGATGACCCAAATATCAGCGCCACTGCACCTCAGTCAGCAACGATCCTGCAGCCA
CATTGGTATCTGCTGCGCTCTGCAGCTACTAAGCCACTCACCTCTCTTCACGTGCATCGAGAAAACTGCGTCCAACTGGACACGAAACAACTGCTCGGCC
GCCTCCACACACTTGACCGCTTTCTTGATGCCCCCACTCACCGGCAGCctgcagcagagcagtcCACAGTCACACTCAACTCCACGCAATTATCTCCAAC
TGAAGTGGCAGCCTCTATTGTaccttcttctgcttggctgTTCCacttgcttctgctgctgttgaagctggaaactctccacgaactgcagcagctcgtc
gtaaAGGCTGCAGCACATCGACACAACGCTTTGGTCAGCACATTGGACAGCAGCTAACGCTCTAACGGCGCCAATTTCTGGTCAAAACGCACCACGGGAC
CTGGCCACGCATGAAGAGCAAGTACTTGACCAGATGCTTTGTCACGGACGCGCGCAGCTCGCCGTCCAGCGACGTCCGATACGTCACCCGCAGCGCCATC
ATCGTTGGACGTTGGCAAGTTGCGCGTCGCAAAGTTGTCTTTAACAACTTTAAGCTGTTAATTTGCGTTTAATAAATGTTAAGTTGCGTTTAAAGCGGAC
CTTGATTGTTTCGGCCAGTCTTGAATTTACCGTTTAGGATGGAGGTCGCAGCGCATGCAGACGACTACAACGCGTCGTTCCGCGACACTGTGTGGCTGCA
GTCCTTCCCTCTGAACGCGCAGACCGTGCTGCACTACTTCGCGCTGTCTCCGTTCTACGACCGCTCGTGCAACAACGAGCGCctcaagatgcagcgccTG
GGGCTGGACCAGCTCAAGAACCTGCGCGGCGTCgagtacgagctgctgcccaacgcggccaagcagctgccgcagcagctctacatAATCCgcaagcagc
gccgcagTGGGCGCACGCAAGTGGAGCCGCTGGCCATCTACTACGTGCTGGACGGCACCGTGTACCAGGCGCCCAACATCCACGCCATGCTCACTTCTCG
CCTCGTACGGACTGCAGAGTTTTCACTCAGTTCTAATTATTATACTGATGAGTTATTATGCTGTAGAAAAAATGCAGTTATCGAGTGAACAAGGCGTTCC
ACGGACTGGCGGCGGGCGTGCGCTTCAGCCCCACGGAGGGCTACGCGTGGGACTTTAGCtccaaggacaagaaggagccTGTCATTCCTTCGGAGCGTGA
GTTGGCCGCTGTATTACTATGAAGTGAAAAGCGTAGTTGAGCTGATGCCCTTTTGCTTGTGGTTTGGTGGGAGTAGAGCTGCAactgaagctcaagcaga
agtacgagaagatggagaagcagcgcgagaactCGGCGCGAGTAGATTCCATCTTGATTCAGCTGATGAAGAAACATGCACCTGAAATtgccgagaagct
ggagagcaacaatgctgcggctgcagcaggagaggATCCTGCGGCAGCGGGCACCATAAAGCGCGAGAGCAATGTTGCTGCCAGTACAGAGGCTGCCAAG
CGGCAGAAAGTTGTTTAAGCACCCACTAACGGAACCCAACGCTGTTTTCCTAATCTCAACTTGTTGGTGTTATATGTAGCAAAGTGCATGCAAGTGTGAT
TATCACATTGCGCTCGGATGCTTTGGCACGACTTTTTGGCTATAACTAGCCCCTTCAAAGCTGTGCATAGCGCATGTGGTGACTCTTGGTCACGACTACC
ACAGCAACTTACTGgtccttcttgttgtccgGTTGCTCAGTGTATTTGCTGATCACCTGGTCCATCAGTTTGCTGCCGCGCTGCTTGGCATACTCGATCT
TATCCTCGACACTGTCGGCAGTACCTCCCATTTGtgacttcagcttctcgctgGACGGCGCCTCACGCGCCATCATCATGCGCGgttgcttcatcttgtt
caCGCTGGCCGTCCACTTCTTCGGGTAGCGGCGACGCAGCATCATCAATACGAACAAGACAAGTAACGGAATGCCGAAGAACGCGACGTGTCGAGCGCAG
ATTCGGTTCGTGGGCAGTGGCAGGCAGTACTCGCGTTCACCGACGTTCTTCGCAGCCTCAGAGCTCTGGTGCCATGTATCCTTAGCTtttcctcctgcag
cttgtaTCGACTGGGAGACACGAGCCTTGACACTCTCGACACGTTCGCCCAGGTCGGTAATCTCAGCGCTGAGCTTCTCGCTCGCCGTCTTGAGCGAATC
CATTACGGCGTCACTCATCGCGTCCGTCGGCACCGGAGCAGAGCCCGGCAGCCCGGTGGACTCACGCGCCGAGGCCGCCGCCTCGCGCATCACCTCATTC
ATGTGCTCCATCTTGCCTCGCGCGTACTCCCCGAGGTtctgcgcttcttcctggAGCTGGTCCAGCGTGCGACGACCGCGGTTGCCCACGTCGTCGCGCT
GACGGATCTGCTCCGCCTCGGACAGCATCTGGTCCACGGCCTCGTTCGCGGCCTCCTTGGCGCCATGTTCCTTTGGCAGGTGGCTCTTCGCCATACCCGT
GGGCATTCGCACCATGTTGAAGTAGTTGTCGGGGATCTTGTAGTGGGGTTTTCGGCTTGGCTGCTGGCCTGCTTGTTGCAAAGTGAGAGTTCTCCAAGGG
CTGGAGAGCTTGGGACGAGGACGGTACGAAGGAAAAGCTCCCAACTGTCACGTTCACACACCCACAAAAAGTAGTAGGATAATAGGATCAAGTGCAGGTC
CCATACAGAGACAAGAGGAGAGAAGGGAGAAGAAAACAGCAAATGGTCTAACGATTGTTGCCtttgacttcaacatggcaCAAATCTTATTTTCAGCCAA
TTGTTATTGTGTTTGACTTCAAGGTGACACAAATTTTATTTTCAGCCAATTCGATCACGTTATTTTCCCCGCTGCCAGCCATTTTGCCGAGATCAAGGCT
AATGGCGCACCCGGCCTTCTCGTCGGCCGCGCAGGTGGACGCCGTGGCCGCCTGCTCCCTGCCCAACGTGCTGttctcggacgacgacgagaatgTGGAG
GAgccggagctgccgctgctggccgtggcgCAGTCGCAGCTCGAGGGAAACGTCTGGAACGGAggcgtggcgctgctggacgccgccACGAGCGAGCGGT
TGTGCgaactgcagctggagactgGCGTAGGGTCACTGGCCTGGTGCGGCGTGGACGGAGAtgtgctggcgctgggctgcgacgacggcgacgtgcGACT
GGCCAAACTGTCAACGGACGTGGCGTTCGCTTTTGTGCCAATTGGCGCCGGACGCAGCAACGACTCGACCGGCGAAGAGGACGCAACGGCGGCTGGATGG
GGACACGACGATGTTGTTACGGACGTCAGTGCCTCGACCGTCGAGACGACGCAGCTGGCCACGTGCAGTTGGGACCTCACGTACGTCGCAGAGGAGGGAG
AAGTCTACCAAGTTACAAGATGACACATGCACTAATTATTGATTTGTTGGTGTGTATGGGGTAGGGTGAAGCTGTGGGATATTAGCGCGATGGACAAGAC
GGTCGCTACGTTCGACGGTGGGTTGGATGGAGTGTTGGGTTGAGATCTGACGCAATTTGCTAATGGTGACGAGTTTTCCGTGTCTGCAGGCCACACGGAT
TTGATTTGGGGCGTGGCGATGAATCCGACGCACGCGCATTTGCTGTGCTCGGCTTCGCAGGACACGACGGTGCAGGTGTGGGACGCTCGTCGCCCTCAAA
GCGCGGCGTTGGCGGTGTCGACGGTTCTGCCTGCGCTGTCGGTGGATTGGCACCCAAAGCAGTCTACTGTGTTCTCGGTCGGTCTGGAAGACGGCATGGT
GTGCACCTTTGACGTACGTTCACCACACACGCCGCTGGCACGACGCGAAACCCACGGAGCAGCTGTGCACGTCGTGAAGTACTCGCCGTATCATGATGAC
TTGTTGGCGACAGGAGGTGACGACGGCAAGGCGTTCGTGACTACCGacagcttctcgtccgaTCGCTCGGCATGCAGTGGCGTCCGCGAACTGCTGGTTG
GCGAGGAGAAAACTCCGCCGCACCGAGACTACGTACGTGCGCTAGACTGGTTCCAGTTGGCATCATTTCCTTCCGCTGCCGACAAACAGTTCGATACGGT
ACTCGCCACGGGATCGTGGGACAAGAGTGTGCACAAGTGGAGCGTTGCCGACTACGCAGCTCCTGTAGCGGACAACTTGTTTTCACCCGCAACTTCTGGA
ATGGCAATGCCAGCTGCACCGCCGGGAGTACCTGTTGCGTAACAAGCTGCAGTATAACGTGCTCAAGTGTCGGAAAAATCTCTTCTTCAACGGATACTTT
TACTTACTTATTAGAGTTCATATTCTACAGGGTTGacgagatggtggtgacgcATCCAAGGTtcctccagcgcctgctcAGGCGTGAGGCGCTGACTGGG
GTCCCAGGTGAAGCAGTTTGCCAAAAATGTCAAAAATTCAGGGTCATCGGACGTCACTGCGCTTGTGAGGCTTCGTGAACCAGGCATGCGTCGACGCCCG
CGCGAGTTCACGAACGGCTTCGGGACGTAGTCCACCGCCTGGATATCCGCAAGGTTTGCCACTTCATCGAAGAAGTTGAGCCGTCGCTTGCTTTTGCGTA
CCATTTCAACCGGAggcatgcccagcacctcCATGATGCAAGCAAATTGTTCGCGTTCGTTTTCGCCGGCAAAAATCGGATGACCTGTGTGCAGTTCGAC
CAGGATGCACGCAAAACTCCACATGTCGATAGCACCCGAGTATGTGTGGCCGAGCAACACTTCTGGGCTGCGATAAAAGCGGCTCTGAATGTACGTGAAC
ATGGGGGCTCCTTCCAAATAACTGCTGCCGAAGTCGATGAGCGTCACGTTATCCACGATACCAGTGTCCCGCTCGTCTCCTGCCAAGTACTGCGCATCAA
GCAGTACGTTTTCCGGCTTAAGGTCGCAGTGAAcaacctgttgctgcttgaggaaCGTCAGCGCCTGTGCCAGCTGCTTGCCAACTGTACGCACGCTGCT
CATGGGCACACCGTGGAAGTAGCGCAGCTTGAGGAAGTCGTACAGGTTCGTGCCCAGCACCTCGAAGGCGATGCACACGTGGCCGCGGAACTGAAAATAT
TCCTCCATGCGCACGACGTGCGGGTTCTCGTcacaagctgccgctgcacgctgaagctgcgccaAGAGCTGCACCTCCGTGAGTGCCTGGTCGCGATACT
TTCGTCGGTTGCGGATGATCTTGACGGCTACCTGTTTGCGAGTGCGGTGATCCAGACAGCAGACAACCTGGCCAAACGATCCCTGGCCTAGAGCGGTCAG
GACTTCGTAACGAAATGCCAAGTGGTCTCccatcaagaccaagtaGTCTccgtactcgtcgtcgtagccGTCATTGCAGAGCTCCGTGGGCAACTCGTCC
GGCTCCTCGACGTGCGCCGCCGCCTCATCTCCATGCACTGGCATGTCGTTCTGGATCTTGCCATTACGGCGACTGCGCTTGACCGCCAGCGTGGACACGA
AGCGGATCTCGTCGTACTGCTGGATCTCCACACGCTCCAGCGCCGTGAGCTCCGCAGCTTCCTCTGCAACCAGCAAGAACTGTTTACCAGTTGGAGGACA
TGGCGCCGGTTTCCGTCGGACCTCCGTAGCCACCTCGAACGTATCTACGCGAGGCTCGTGCTCGTGTCTCTTCCTCCGCTCCGAATCGGCGTCCTCAACA
TCGCCGGCGAGTCGGAGTCTCCGctgcgggtgctgctgcttatGGTCgtccttgctcttctccttcttgtgctgcagttgctgcagcctccgccGGCCGT
TCTTCTCCCCGAGCGGGCGATGCGGCTGCCAGAACTTGCGCTCCTCGGCGGCAGGTGGCGTCGCGACGACGCCCGTGGGCGCTGAGCTGTCGCCagtggc
cagcagcgagctggtggtgcgACGGATCAAGTCCAGCGGCCGTCGGTTGAAGAAAATGTGCGCGATCGAGGACGGTTTCTTGCCGGGCGGCGCGGCTGAC
CAACTggtgccactgctgctactgtcTGTAGGCTGCTGcgcctggagctgctcaaaTTTGTGCGGCGCGGCGGCTGAGCCGGAGCTGGGTGGCGCCGGAG
TCAGTGCGGGCAGCAGGCGGTGCGCTCTCGGGGGAGGCCGCAAGGAGCGGGACTGCTccatgctgttgctgctgctataCTGGGACACTGGGCGGTGACG
GATACTCTGTCGCCGCTAAATCGGGAAGTGCTTCTTTTTCTGCCTCCTTTGCGCCACGCTTCATGGTGTTCTTCAACGGCAAGTCTCACGGCTGGAAGCG
AGTGCCAAGGGGCCACAAGATTTGCCAGATGCAGGTGTCACAGGCCACGAATTATTGCGTCCGGTTCTCTGATGGCATTGTCAGTGTGAATCATATGCAG
CTGGGTTCAATGATTCTCCTCGCGAAAATTGGTTGGAAAAACATTGTTTTGGGCGACTGCTGAACCCATCACTGGGCGTTACAGCACGAGAGCTCTTGCC
TGTATACGAGTCGTGCCTGTCAAGACAAGGCGGGCTGCGACCAGTCTGGCGACGCCTGTTTGCCTGCCGCGCGCAGCCCGCGCGGTCTTATTCGCAGCGT
CGAGGCCGCGGCCCAACTCTACTATCGATAAGCTTACACCGGTAGGGTGACTTAAGCAGACAGCAAGCGCTGGTGCGTGGCAAGCGCGATCCTTCAAGGA
TTCCTTGCGCCGGGCGTCCGTGCACGTGGGCGGTTTCATCAGTCTACATCTGAGTCGCAGGTGTGGGACGGCTCTCGCtagacgtcgtcgtcgacgatgc
ctGGCTTTAGCATGCATggcggcgcgctgctggagggaTCGCCTCACCGCAGGGAAGCCCGTCACGAGTTGCAGTGCCAGGGCTGCCCTGGATTCAACTT
TTCTGATTCGCAGGCTCTATAGAAGTTGTAGTTGCCGTTCTACTACCGAAATTGGGAATCAAAATCGGCAATTGCAATTTTTCGGTCGCTGCCTAACGCT
CGAAAGAGACGTGGATATCCACCCGTGACAACTGCCCGCGGACAATCGAGCATGAATGAAACTTTGGGGGACATTGCATTGCATCGCATTGCATCGCATT
GCATCGCATTGCATTTGCCGCCGCAGCTCGTCACCGGCGGTGAGAGAGGAGTGGCATTTTTTTTCGGAACAGTAGTGTTGCACTTGAGTGCCCAGATCGG
CTAGCGTCCCCGGACGTTGGTGTGGGCCACACCGGACGCATAACCAATCTCGCTCGTGTTTTTGTAACTTCCGCACAAAGCGGGAATGGCGAATGCGGAC
GAGAGACTGTTGCGGTCGTTGCGGCGGCCGCCTTTCATCTTGATGATCGGAACCTCGGCCCGATCAGATCGCTCGACCCGATTTGCTTCGCGCCACCGGG
GGGCCGGCGCGGCAGACCTTCTCTCGCACGCCACCGCGCAGCGTCTGCGGTGATATCTCGCCGGTCTGAAGTGACTCATTCAGTCCGCAGCTGCCATCGC
CATTTGGACTTTGATCCAAGGCGTTAGGTTAGCCGCGTCATGGTGCACTCCATCTTCGGGGCCGGGATAAAGACGCGCGATAGGGGCAAGCCGCGACGGC
TCTGTCCGCGGCGCGGTGGTCCCTCCACTGTCGCCGGGCACCGAAGTGGCATTGCCCTCGGAATGACAATGCCGATGGCATCACCTCGGAAAAGCGCGCG
AACGTGCGTGGTTTACTCTTCAACCTAGGCCTGATATTCCAACTCAGGCCGAGGCGTCGACATCGTTTTGGCGTGTAACTTGCCGCCGCAGCGGCCACGG
CATTGCCGACGCCAGAGTAGGCTGCGAAGAGCTCGCTGGCTGGCAGGATGACCCGAGCTGGTAAAGCTTTAATGGAGCTCCACTTGCCTTAGCGCCTAGA
TCGCGCCGGCTGAACCCACTGCCCGTTTTGGCAATCGCACGCCAGGCATAACTCGGCGAGAAGATATCGTGGCAGACGAGGGTCCGCCGGGGAAAAACTT
GCTGGTTGACCTTGAACCAGTCAAAAAGAGGGTTTCGAGGAGGCCAGAGCTGCGGAGAGCTcgcgctggcagcagcagccacgaggTCAACGAACCATAG
TCGGCTGAAAaacgcgaagaaggcagAGAGCAGCGCAGTTGGCGAGGAGATCGAAAAAGAGACTCCATGTGagctttgctgcagcaccgagtGGCTGCAG
TAGACAGCGGACAAGAGCAATATTTGCTGCGCCGGGGTCGTTTCGGTTAAGTTGCAGCCCGCCGGCCTGCTCCGCCGCCAAGGACATGCACCATCAACTT
GATGATCAAGCTGCCCGACAGCTTCAGGCGTTTCTAGCGGAAAAAGGCGCTGGCCTAGACCTAGCAGCGCCCTTTTTCGGCGCTACCATGACATTTCGCT
TTCGGCGCGGCTGCAAAATTCACCCCATGCTGGCAGCATGCTGGGCTGTGTGCCGGCTGGTAGAGACGGTGGCGGGCACAGGAGTCTATCATCATCGCTA
CTTACGGCGCCTTGGTCACCTCGTACGGGCATTCCGGGCCCTGGATACTGGGCTGCCGCTGGCAATCGAAGGCATCGATGTCGATATATAAGCCGTCGCG
ACGGCGCCGCCAACAAGAATCAGAGCGGTACCTCCAGTTGCTGCGAGGCGGCCAGCCAATTGGCGTGCCTGCCCATCTTTCTTGTTGTGATATTCGGGTC
AGTGTTATTGGGCCGATTTTGGCCGGGCGACGCATCCCACCCGAATTTGGAAGGGAACAAGTTGGCGTGGCACACTCCACGCCAGTGCCAAGCCTTGCTC
GCACCAGCCCAACGCCGGGCCAGTTACCATTCGCCATCTTGCTGGCCACGACGCACACAGACAGAGCCCTCTGTAGCCTGGTTCGTTCTCGAGGAGGGAG
TTGGACCCGCCGCTGCTAGTCCAGACAGGGAGCAAGCAAGCATCGATCCGCGCAGCCGAGCGAGACGCAGCGCGGCCGTGCAATCACAGGGAGTGACAGG
GAGCGACGAGAGCAGAGCAGGGATGGAAATCGCCAAGAACGTGCGCGACTTCCTCGTGGGCATGAAGGAGACGCTGTCCCCCGAGGAAGACCAGCTGCTG
TCGAgcctgcagacgctgcacgaGCAGTACCTCAACATTATGGAAGACTTCTCGGTGGAGGTGTCCGCCAAGGCGCTGAGCATGAGCCCGGAGGCGCGCG
TGCTGGCGCACCAGCTGCGTCTCAAGATCTACCAAGACTGGCGCGCCAAGCTCATGGAGCGCGTGTTCGACAACTCGAAGGAGATCGCGTCGGCCGAAGA
CGCGGAGACGCACAAGCCCGGGTGCGACTGCTGTTACTGCGAGCTGACGCGGCGGCTCGGCAGCTACGAGACCGTGACGGCCGACTACATCGAAGCGAGT
ACACGGATCAAGAACCCGGAGAACGACGCCGGCGAGGACAGCGCCTTCCAGATGCCGGACTTCCTGGCCACCTAAGGTGTTACGCGGTGGCACGCCTAGC
TAGTTAGGAATTTCTCGGCAGCGAGTGCGCCGGGAACGCCCGCGGATCTCGTGTGGAACGAAGAGAAGGACTGCATCGCGAGATGGGACGTCCCCGGGCC
TCGGGAAGGCTGCTGAGCAGTACAATACGTGGAACTACTACTACAAGAAGAGGCGCTCGCGCGGCGCCGCGATCGTGGAAGTCGCGGCAGCCCCCGGCGC
GAGCGAGAGGGTGTGTTTGGAACAATAGAGTGCTCCGACTGCGTCTTCGCCGTCACCGGAAGCGCGTGCATTACAGTCGGTAGTGGTATTATGATCCCCC
CGCCTCGGTGCGCAGGTTTATAAGCAAGTTTATAAGTACAAAGGGCTCGTTTGAATCGTTCGCTAGCTGGTAGTGCGCAGGGGGGAATGGAGGGAGGGAT
CGATCACTCAGCCAGTCAGCTTCGCACCACCCCCCACCCCACTGCACACGCGCCAGCAAGGAGAAACGAGCCGAGCAGAAGAGTACGCGCGCGTGCAAAT
AACCTGCCGAGAATGCAGAGAGCTTCAGACAGTTCGTtcattgttgttgtcgtcgtcgtcatcgtcggtGCAGTGGTCTTGCCCCCCAAAAAGTATCCTT
TCTGTGGTGCCGATCAACGTGCGCTGTACGTGGCGCTGTACCTGGTGGGGCCAGCTCGGCGTCGGCCCCACTTGCCACATGGCCTGCCACGTTGGCCTGC
GCGGTTTCACGCCcacgtggcgctggccatTTCGCCGGCAGCAGgagcggcggcagcgtcATGATATCTTCATTGCATTGCGCGCGGCAGGCGGGAGTCA
CGCAGGCCTCGCTCAGGCTGGCCTGCATTTTGACCAGGCTATATGCCTGGCGTTGCACATACGCCAGCAAGGCTCCTAGATGATGGCGAGTGACCTCAAT
TTGCGCAAAGACCAGCAATTGCTCGATTCAGAAACTCGGAAAAATAGTATAACAAACCACTCCTATTCGCACTACTATATAGGATAGCAGTAAATCAGTT
TTAACATCATCGACTCTTACAAACAGAAAGACAAGCGCACCAGGCACCGAACTGAAAGATCAGGTTTCTGATACATCAGGTTTGGCGGGATGTCGCCGTT
AAGAGAAAAATGCCACACACATTTTGCTTTCAAGTGAGAAAATGGAGCGAAAAATCTGGTTTATTGATCTTGGCAACAACGACCACctgaagaagacaag
caCTTTGTCGCGAGCCGGCCGTTTCGCAACGagcaagttgcctttttgcCGTGTACACATTTTGGGCCCGACGCGACCTCAACAGAGCAAAGGTGCAAAA
GAAACTTGTCGGCCCTCTCTTTTCAGAGGTATTTTGCTGTTGGCCGTTCGTCCACCAAGATTCTTGGTGCGCGTTGTCCCCTAGTTGCTTCGCCCCCTCT
CTGCCtcgcaagttgcagtgctcGCCGGTCGGTCATTGCAGTGCAGCGGCGGTCCCCGTCCGTCCCCATTTTCGCCAATTCCACTGGGGTACTGGTGACT
CTTTCCTTCGAgcattgctgcagttgagtCAAGCGCCACCAATCCGAGAGTGCACCGCCGAAGAAGACAGAGGCCGTGTGGCCGGCCGGGCGCAGCCTTT
CCATATTATAGTGCAGCGCAATGCGTCTGCCGCGAAGCAAGCGGCACGCACTCCTCCGTATCGTTATTATCAAGAAGCTCGGAAACTGGACCTGCAGATT
CTGCAGTGCCCAAGGATGGAAAGCCGGACGGCAGCGACTTTCCAAGGAGACCAGCGAGCTGTACATACACTAATAATACTCGTGCAGCCACCTGGTGATG
CTCGACGCCACATGACTGGCACTCGTTGCGGACGCCTGATCACAGCCTGTGATTCACAGGGCGCTTCGACGCCACCAATTCCTTGAGGAAACGAATTCCG
TGGCGCGAAGACGACGTGTAGAACGCACGTCAGCCGAGGTGAACGGCGCATTGTGGAGACCTCGCATCTGCTTGGTGGGTCACCGCCGTGCATGGCACGA
ACCAAGTTACCGAGCAAATAAAGGACGCGCTTACCGTGAAGCTCCGACCATTTTCGTAGTCGCGAGTTTTCAAGGCAAATTTTTGATTAGCATGGAGGTG
AAATGTGACGGGATGGCCGGGACTTTCTGTTGCGGCGaccgagagcgagagcgtTGGCTGGTGATGGAGCAAGCAGCATCGGCCTCGTTTGCATTGCGGA
GCATCGCGGCGATGCCATGACGGAGGCTTAGCACTCGCTTACGAGCGAGAAAAGGCGAGTCACAATCAAACGGCGGCGCATGCGCGCCAGCCAAGCCCTG
AGAAAGTCTCGGCGCGGCGCGATTGGCGCTTCTGCTCGCGGCAACACCTGTGAGTCAAGCGGCGGCAAAACGCTGCAGCGTTTGCATCAAGGATCGCTGT
ACATTTACATTCACCGAGGAGCGTGCCCGCCACGTCGAACGAAGTGACCAgcaccatctgcagcagcaaccagcagcgagtcacACCACTGGCGAGTCGC
CAGTGGTGACTGCAGGCAACCAGACGAGGAACACCACGCGAGCATTCTGGCGTTGTCGACATAGCGG