Description :
From Genome Similarity Track
Location :
Scaffold_230:37708- 42524
Sequence
4816 bases(100 bases per row)
CTTCCTCTGACGCTAAAGCTACGGCAGCCCCGCTGCACTTGGTAGCACTTGTAGTCAATCCCGCTCCTGAGTCGGTTGACTATATCCTCTGCGAGGATGG
AACACCCCGTGTTCGCGAATTTGCCCCCGGCGCAGCAGGACGCGCTTACTAAGCTTATGTCCTTGCTTGGCCCGGAGGGCGTGGCTCATCTTGCATCGCA
AGGTCCAGAGGCGGTCACTGCCAGGCTGGAATCGTTCTCCCGCTACGAGAACGCGCTCTTGGAGCATGTCCAAGAGAAGATGAGCGCCGCAACGGCGGCG
GCGTCGATGACGCGTGAAGAGTCTATGAGACTGAAACCGCTCATGGTGAGCGTAAAAACCTTCGAGGGGAAGGATGGAGAGAATCTCCTTCTCTGGACCC
GTGAGGCCGAGATGGCCATGGGATCGGCCCTGCTCCAGTCTGAGCATCAGCGCGTGGCGCTGGCTATCTCCAGGCTTGGAGGTCGCGCTCGCGAATGGGC
ACTAACGTGCGGCACGTCTGTTGACGCTGCATTTCCCACTTGGGATCAGCTGAAGCAACAGCTTTCGCGCGTGTTCGCGCCGCCTAATCAGGCGTACCGT
ATCCGGTCAAAGTTCCTTGCTACCCGCCAGGGTAAGAAGGATTTATTGGACTATGTCCAAGAGTTGAGAACTCTTATCGCCGGAATGGCGGGGGACCCTC
TTCCGGAACTGGTCAGCGTGACCGTGTTCATGGAGGGACTTCGTGTGAGCGCAGCTCGAACGGAAGTGTTCCGTGTACACCCTAACTCTTCGAAGAGGCG
GTGAATGTGGCATTAAATGCCAAGCACAACTTCAGGTCGGCTCGACCTGGTTGGAGCGCTAGTAGCGCAAGCTCTTCGAGCGGTCCAGAGCCGATGGACC
TCAGCTATGCTGAAGATGAAGAAGCGGAGCTTAGGCGCGGGGCGTCCTCCTGGGGGAGAACTGAGTTCTGTTGTGCCTCGAGGAGTAGAGGGCAACAGGG
CTCAGCCCCGAAGAGAGCTGAGCTCTCTTACGAGAAGAGTGTGTGCAAGCCGGGCTTGCTGGTCGTTCAAGCGAACGTGAAGGATTTGCAAAAGCCATGA
AGAGTCTTGATTGACTCGGGAGCCTCGGGCAACTACGCCCGTCGCTCCACCCTGGAAGGGAGTCAGCTGTATGCTGAGGCACTGGAAGTGCCAACGAGAG
ATACGATCTCTGTCCTGTCTCGCGACGGGGACACTGGTAACTGTGTCAAAGGTCTCTGTCGACCTTGGCGTGAAGTTTGAGAGCTTCGATAGCGTGGAAC
GCTGTTTGGTCTTAGCCCTGGATGCGAGGTATGACCTCATCCTGCGCATGGCATTGCTGGAATGCCATGAGCCATGGATCGACTGGAAGGCGAAAACGCT
GGGTGCGTCGCACCCTGCTCCTAGTGGAGCTTTGGTGAGTCATGAACCCACCTCTGCTAGGAAGCAGAAGCGCTTTTGGCGCGAGTACGAGGCCGAGGCG
GCCGTAGTGCTGGACATTGGTATGTCCGAAATTGTTAGCAACGAGGTTGCTGTTTGCCCTGAGGGCGTACGTGGTGCGGCACGTTATCCGCTGAGCGGTG
CAGGTCAGGTCAATGACCACCTGCTGGGTCCTGGTGAGAACGAGCGCCGAGTGGCGCGTAATCCACTGAGTGGTACGAATCTGGTCGATGACCTACCGCT
GCGTGATCCGAGGGTCGCGGTCGACTGCGAGTCGAGGCATCATGGGGGTGGCCCAGGAGATGCAGGTGAAGTGACACCTAGTTCACTGTGTGAAGGTCAA
GGACCTCTTGGCGTTCAGCCGAGTGTCTTGCGAGACACTGTATCCTCTTCGAAGAGTGATGGTGCTGCTGCACCCGGCGGTGGTGACGGAGATGTCGCCA
CACCGCCCTCTTCCGGCCGGGCTCGGTCGCGGAGGGAGAGGAGAAGAAGACGCAGGGTGTCTGTGACGTCTTCGACGTCGGACGATGTGTCCAACGTGAC
GAGCGGTGATGCTCCACGTGATTGCTGTGAACCGCTGTATACACGGCGATCCTCAAAGATCCTTCTGATCCCTTCTACCCGGTGTTGAAGGAGTATGGAG
ACGTTGTCTCGAAAGACCCGCCGACGTATCTGCCTCCGGATCGAGAGTGTGTCATGAGATTGACCTGGTCCCTGGAACCAAATACTGCGTAACAAGGCAA
TGGCCTTTGCCGAGAGAGCAGTGTGATGTCATTGACGCATTCTTCCGTGCGAAGCACGAGGCAGGGATGGTGCGTGAGAGTAAGTCTCCGCACTCGACAC
CCACGTTCTGTGTCAGAAAGCCGAACGGCAAGTGGCGCATTGTTCATGCTTTTAACAAGCTAAATGCGGCCACTACCCCGGCGCAAACGCCGATTCCTCG
CAAAGATGTTCTGCAGAACCACATGGTAGGCTGTACGTTGTACAGCGCGCTCGACTTGGTCGATGGCTACTACCAATTGCTCATGAGAGCGAGCGACATT
CCGCTGACAGCGGTGAGTACTCCGAGCGGTATGCTCTGGGAGGAGCTGGTGATGCCCCAGGGGCTGTCAAACGCACCAGCAACGTTCAATCGTCTTGTGA
CGCAGTTGTTTAGGCCCCACCGGGCGTACGCTCAAACGTACTTTGACGATATATTCGTCCATAGTCGTGCCGAGCACGGAAAGTCAGACGTGGAAAACCA
CATTGACCACTTGCGAGCGGTGCTCGAGTGCATGCGCACTAATAAGTTGTATGTCAACTTGGACAAGTGCGTCTTTGGCGCGGAGGAAATACCTTTCCTC
GGGTGCTTCGTTGGGAAGCGAGGCTTAAGGGCAGATCCTGCCAAAGTCAAGGCCATCGTGGACTGGCCGGTTCCCAAGAACCAAAAAGACTCACGCAAGT
GTCTAGGCTTAGCCAATTACTTGCACAAGTACAGCGCGAATTACGCGGAGATGGCTCGGTCATTATCAGATCTTCTTAAGAAGGACGCACCATGGTGCTG
GAGCGTCGAGCACGACATAGCCTTTGAGGCTGTGAAGGAGAGCCTCCTCCAGGCTCCGATCCTTGCGCTACCGGACCCGGATAGTTCGTTTAGCGTCGTC
TGCGACGCCTCCGATTTTGCGATCGGTTGTGCTTTACTACAAGCAGACGCCGAAGGGCGTGAACGCGTGATCGCGTTTGAGTCTCGCCAGCTCAAAGCTG
CAGAGAAGAACTATCCAGTTCATGACAAAGAGCTACTTGCAATGAAGTATGCTCTAGTCAAATCCAGGGTACACCTGCTAGGCTCTAAGCCTTTTGTGAT
CTTTACTGATCATGCGTCGTTACGCACTGCGACACAGTCGCCTCATCTCTCTCAGAGAATGGCAAGATGGCTTTCCTTCTTTGCCGAGTACAACTTCGAG
GTGAAGTACAAGCCGGGGCGGCTTAATGTAGTGGCCGATGCGCTCTCGCGCAGGCCGGACTACGAGTTAGCCCATGTCACGACAGTGACGTCGTCAGTGC
CTGACTTGATACGCGGAGCGTATGCACAAGACGACATGTGCGTAGCGCTGCTACGGGCTCTTGGGAGCGAAGAGTTTCTAGACTCTGACAAAGAATTGTC
TGGGCGCTTACGCGCGAGGCTGCATCGATACTCGCTCGATGGCGGCCTGCTGTACTACAGCACCGACGCTGAGGATAACCCTCGTGTAGTCGTTCCTCAT
GATGAGGATCTCAAGTATCGAATCCTCTATGAGGTTCATGATACGCCCGTGGGCGGGCACTTAGGTCGGGAGAAGACCTACGGCTCGGTGAGCACGATGT
ACTGGTGGCCCAAAATGTATAAGTGGGTCGGCACCTATGTACGCACGTGTGAGACGTGTCAACGGACGAAGTCCGCGCCGAGCACGGCAGCGCCATTGGC
GAGTTTGCCTGTCCCCAAGGGATGTTGGCAGTCCATGAGTATGGACTTTGTGTTTGGCCTTCCCAAGGACAAGGCAGGAAACACGGGTATTGTGGTCTTT
GTAGACCGATTGAGCAAGATGACTCATCTAGCGGCGGTGCCGGACACCATAGATGGTGAAGGTACAGCTTTGCTGGTTTTTAGACCGAGTCTTTCGCCAA
CATGGCTTGCCTGAGGCAATTGTCTCGGATCGAGACCCGCGCTTCACCGCGAAGTTCTGGACGTCCCTCTTCAGAGTGCTTGGCACTCGTTTGGACATGT
CCACAGCGGACCATCCGCAGACCGATGGTCAAACCGAACGCGTGAATCGCGTTGTGGAGGATATCCTCCGAAGCGTATGCGCTGAGGCGCGAAAACGCTG
GAGCCAGATGCTCCCACTCGTTGAGTTCGCATTAAATAATGCAGTGCACGCCTCGACAGGCTACACTCCGTTCTATGTGAACGGCTTGGATAACCCTCGC
GTCCCACTGACGCCGCCACGCCCGTGGCTTAGGGCTTGATGGGGGAGGGATAGCCGAGCGGCTAGCTGATGTCAGCCGTGTTGCGGTTCGCAAGCAAGTC
GATGACTTTGTTTCTTTGAGACTGAGCGTAATGCGTCAAGTACGCGACGCTATGGCTGAAAGCCAAGACACGCAGAAGGAACATGCAGATGCCAAGGGCA
GAAGCAATGTTGAGAGGTTTGAGGTCGGTGACCAAGTTTTATTAAACGCTAAAAACCTACCTACTCATGCAGTGTCTGCAGTCTTCAAGACCTTGGTTCA
TAGGACCGTTCAAGGTCGTGGCCAGGATGGGCCTAGCGTATACGCTTAATCTTCCGAAGAAGATGCGCACGCATCCGGTCTTCTATGTTGGCTTGCTTAA
GCCATATCAAGACCCT