Description :
From Genome Similarity Track
Location :
contig_47:377003- 383984
Transcript NameFunction/comments
g7897.t1hypothetical protein
g7898.t1hypothetical protein

Sequence
6981 bases(100 bases per row)
AACGCGAGTGTTGTTGGTTCTATCAAGAAGACTGGCCTGGGAAAAGGTCTTGGCCACTCGAAGAAGTTGAGCATCCAGCAAAAAATAAAGACGCCGTTGA
AGTCGAAGGCAGTGGCATCGCTGAAGCCCAAAACGATGATCCAGCCACCGCAAGTGGAAGAAGTGCCGGTAAGGCATGTTATAGTTTAGTTCTGCTACCT
GCCTACATGCTCACTCTCTTGTGCATGTTCTGGAGGATATCGAGTTTGCGTACGGCGGACTTTCCTCACCCAATACCGACTCGGCACACTGGGCGAGTCT
GCGCGATGAATTTGTGCGCGATATCATCAACGACACGACACCGACACTCTTCGACGATTTCGATCCCACCGACGTCGTCGCCGGGTGGGATGATGAACGG
GAGAAGGCGATGTTGAAAAGTGGAGAGCCCCCTTCCCCGTGGTGGTCTTCGGCAGATCAGAAGGAAGGCACCGAGGAGGAGAAGGAAGAGGAACACGTAC
ATGACGACCTTGACGATCTGCCACCACCAGATAATCTCCCAGATGATGAGGTTGCCGATTTTGATGATGACGGGCTGCTGGGAGATCTCCTCAGCGTGGA
CGTTGAGGCAGCATGCACCGAATAGTGTTTGCTGTCTTCGCTTGGTTTGACAACATGCTCCAGCTGATGCTAAAGAAGCCCGTAGCTCAAATCTACCTTT
TCGTAACTCCTTCATAACCTATGTAATGCAATATGCAACCGTTTTACTGAGTACCCATCCGCGCCATCGCCAAGAATTTGACAATGAGATCGTCTCCTGC
AGATTGCCAGTCATCAATCGATGCGAAGAAGGAGGCGAGTTGCTCTTCAGGTGATGGGCCCGTCGAACGCTGTCGAGACGGAATAGACGTCCCACGTTTC
GTACAATCCAGCACTTCTTGGGCTCGTTTGACCAGTTCCTCGGGTATCCCTAGCAACAACAACAACTGGTCTTAGGACTTTCGATCACATTCCCTCCCAA
GAACCGAAATAAAACTCACCACACTTTGCAGCAGATGCAAGAGCGTTACTGTGGCTCGAGATACCGTGGCGCAGCTCGTACAACGGGACAGCGTTTGACG
CAGTAGAATACGACTCTGGAGCTTCCGTCGACGCCATAACAGTGCAGACTACACGCGCCGCGTTGTCCGACGTTTCTGACTGTTCTCCGCTACCTTGAGG
TGATGGCTGGTTGGTCACCAGGGATGGCTCAAGCAGATTGTCGCGAAAGATTTCCTGGATGCAAAGCAGCATTAGCAAATGGCGAGCATGTTGAAGCACA
GTTTTGACAATTGTACCAGGAAGTGGGTTGTCAAGATGACACGCGCTCTTCCATGTGTAAACGTTTTCGTTGACAAGTAGTTGATTAGTGAACTCTGAGT
GGCAACAGTTCGAAATTAGCACCAGAATCAATAGTACAAGTCGTTCCGTACCAGCAGGGCTATTCCATCCAGCTCTGCAGTTCCTTCACATACGATGTTA
GCAAATATGTTCAGGCCCAACAGCATTATGCAAAATCCATGCAAACCTTTGCCGAATTCATCGATCAAGAACAACGATCGACCATCACCATGATTGAGCA
TCCATGCCATCTGATTATCACACGTTCATCATAATACTGTTTGTTGATTTCAAATACTTCGAAGTATTACCTGGTTGCAGTCGATCGTGAAGGAGCTCTG
CGATACCGTTGCAGATTCCATGCTACGAAATGTTATCATCAGTTTCGTTGTGTGTGATATTGAGGTCTCTGAAACTCACCTTTGGATTCTGGTAAACATT
TTGGTCACCACTCCTAATTCCGCTGCAATATTTTGTTAGAGGTATTGTGCCATATAACGTAACTATCATCCCACCTTTCTCTGCTGGTACGAAGCATCCG
ATCTGTGCCATATATTGCAGAAGGCCAACCATTTTCAAGTACACCGACTTGCCTGTCCGGCAAAAGTTAAGCTTGATTGGCCCCTGAGGTGGCGAAGCCT
AGTTGCCTACCTGATCCATTGTGTCCCGTTACAATCTTGAGTGAATCGCTTGAATCCAGGAAGATGTCGTTCGGGATATAATGCTCGACAAGTAATTCCT
GAAGTGGGTGACGAGCTTGGGTCGCCTTCAACGTGTTGGTGGCGGTGATCTGCGGACTAAACGAACAAGCGTGAGGTAACACAAAGATCGGCAAGTGCTC
ATTGTCGTTGATTTAGCGTACCGGGAAAAATTGAAGCTCTTTGCGCAGGAGGCAAACGAGATCAAGCAATCGAGATACGCCATGATCCCAGTTGTATCTG
TTGAGAAGTACCAAGCTTATCTACTGGTACTGACGTTTGAAACACAAATTGATAAGATTACGAACCATGAATGCTGCTCTCGTACTCTAGAACTGCTATT
GTCAGTTCTTCGAGGAGCTCTGCAGAGAAGCAATATTACTTCAACAGCCCATTTAAACCACATCTTCATATTCGTACCTCTTTGCATGTCAAGAATGTAT
CCTGCGAAATCATAACAAGGCGCTCATTCATATCTGCCATACGAAGCATGTATCAAATAGGTTGATGTACCGTAGATATCTCCGATTGACTCGTCCAAGT
CGCGGCAGCAACCATCCTGCCCGAAGAGTCCATTAGTACTTCGAAAGGGTGTATTAATACGTCGCAGCGCTTGAATTCGTACCTTGTAGTAGAATGTGGT
GTCATCTTCTTGAAATTGAAACACGAAGTCGGGCAACGTGGTGGGCGAATCACAACAGATGACATAGCCTACTTGAGGAATATACTGGACTGTGATCGAC
GACAAAACAGGATTTGTCTCTTGAATCTGAAACGCGACCTCCGTCAAAACCTGCCCCCAACACGAATTTGCATTAGAATCTGTTCATTCCCGTTAAAGGG
CACCAAATCCGTACATTATCGAGATCTTCGTAGCGCTCTCGTGCCGCATCCAGGGCTTCCGATATGCCACTTCGGATAATCACTGTATTTTCCTGTTGGC
TCTCGTCAAAGTCCACGACGTTCCCGAGAAGATTGCTTACGTGAATTAATCCATGCTCATTTAGAGCTCTCGAAAATACGTTCGGGAGTGATGCATTGCT
CGTATCATTGCAGACACTGTCGATGAGAGACCTAGCACAAATGAATAAGAGGTGATAAAAACAATTCATGGCGATTAAAGAGCAACATATGAATGCTTAC
TGGGTCTCCAGGAAACTCCCAACAGAGGTAGCAAATCGGCACCAGTCGCCAACCGAAGCACAGCGCCTCTTAATGCGCTGGAAAATTCCTGCCACATCTC
TGAACTGCTTCAGCTTACCAAACTACATTTTGTAAGATGTCGTCGTGCTCAAAAGACCAAATCAGGGGAAATCCAAGACAATACCAGTAGCTGGCGAAGC
TCGTCATTTTTAGCAGCAGTGAAAAATGCGACGGCGCTGAGGCGCTCATCAATGTGGGCACTGCTAACTAGCGGGGTCAGCATCCAACGGCGTAGCATGC
ACCCACCAGATTTGGTCACAGTGCGGTTGAGTAGACCAAACAGACTGAATCACATTGTCAACAAGCCATCATCGAATGAAAGCAAGCAAGAGGAGGAACT
AATACCTGAAGCCCTCCTTCGCTCGGCCAGACCCCTGCATAGGGTTAACGTGAGTATAGTGGCAATTATTGAGAACATGTCGTAGCACACCTTGACTAGT
GACGGGTGTGCTTCCTGTATTACATCAAACAAGTATGAGCAGCAGGCTCGTAAAGTTACCCCGCGGTTCAAGTCGGCCTACACGGTTGAATATCTGAAGG
GACTGGAGTGTAGACTTGTCGATATACATGAGCCCGTCGAGTGCGACATGCTCCACTGTTGAAAAGTGTATAGATTCTGCGTTGTCCAATTGGTTTCCAA
TCTGCACAAGTCTTTAGTCAAGTCATTGGACGAATATCAATCCCCCAACATACCTTTTCGGTGGATAAATAGAGCAGCAATGCTGTAAAAGTTGCTGTCG
TCAGTACCAAGTACTCGGCAAGGACGGAAATGAACTCAACGCTTACCCCCTGTCGCTCGAATCAACTGCGTGCTTTCGAAATCAAAGAAGCTGCCAAGGA
ACGTGTAGACCTCTCGCCTGTGAAGAGGTTGTATCTGTCAGCACACGGCCAGTGCCAGCATCACCAAGAGTTTCTGTCTCTTGCCTAGACGATCGACTGT
GAGGCGTCCTGAACTCAGCAGGAGCAGCTCCAATTTGCACATGCTCAATCGCTTGGCACCCCTTCAGGTAATTAAAATCTGCTTGCCGATATGGTTGAGT
GAAGACTCCAGCAACCCCCCCCCCCAAAAAAAAAATTGCCAACCTGAATGCTGCGATAGGATAACGAGTTGTCAACAGCTAGTACTTTAAAAGCATGCAA
ACACAACGAACCTTCCGGACACTGACCCCCGTCTTCGTCTGATGCGTTTCGTCGAGTTTCTTGACCATCCGAAGCATTCCATTTGAGCTCGCATTCCGAG
AGGAAACAAGCACGTGGTTCACTTCAAACTGTGTGTGCAGGCGTTCGATGATCTAAGGAGCACGCGCGATCAGCTCTTGGTGTCTTCAATTAGTACAGCA
AGACTGCCGCTTTACCTCCTCCAGCTCCTGGGCATCAGCTATTTGGAGCTGCAACGTCTTGAGGCTCGTCGTTAATGCGTTGTAGATCGAGACACCCAGT
TCGCCTCGGTCGAAGAGAATGGACATGAAGACAAGCTCCTCGTCGTCGACTTCAACGTCGCTCGCGGCTTCGGACAGCCCCTCCTCGTCTCGTTGCTGCT
AGTGCTTGACGTCAGACCAGGATACCCCCCCTTCCACACACACACACACACGCATGAGCCACCACACGGATACCTCTGCTCGACCATGCGCCATCCTGTC
CCGCTGCCAGATGTGCACACTTCAATGCGGAATGGAGACGTGCGTGTTGCCTCTCCCAGGAGTGATGGTCGCTGCAACATATGTGATAAGAAAGGTTCAA
TATTCGATTAGATGGGGATTTTCACGGTCGAATCACATTTTCAAACGGTGAGCGTCAATCACACGACTACAAGATGGTACGAGGGCACTATAGCGTCGGC
ACAGACTTGTGCGTTAATATGATGGTTATGATGCGCTGCTGTAGGCGACGGCTCAGGTCTCAGAGAACCTCATAACGCTCAAGGGCTCAACTGAGATCGT
CACGGAGTTTTTTTCGTATAGCATCAACACGTGCGAGCCCTTAACAACTCGCACCGCTGTTATTGTGGCGTTTCGCAAAGCTAATAGGTCTATGTGTTTC
AGTATTCTGTATCAGCGCGGCATCTACCCTGCTGAAAGCTTCAAGCAGGTCCAGAAGTATGGCTTGAACATGCTTGTGACCGACGACGACAAGCTCAACG
ACTTTTTCACGAAGTTCCTCCAGCAGTTGTCGAGTGCGTCTACATGCAGTTGTATAGCTCTGCAATTCGCGTGTTTATTCACAACGGAAAACTGTAATTA
TGCTGCAATATACAGGCTGGCTTGTGAAGGGAGAAGTGCAGAAGCTTGTGCTTGTCATCACAGGAATTGAGACTCAGGAAGTGCTGGAGCGATGGGCGTT
TGAAGTGCACGCTGAGAACAGCACAACAGAAAGGTGCGTTGGCCCCTTGTCAGCATGGCAAGGGGATAATTGCTGATGCCGAATTTGTTGTTTGTCATGC
GGGCTTCGTAGTGGGGGTGCTACCAAACCCAAGAAGGAGATCATGTCGGAGATTCAGGCCATCATCCGTCAGATCACAGCAAGTGTCTCTTTCTTGCCTC
TTTTGGAGGAGCAGTGCGCGTTTGACCTGCTGGTCTACACCTCCAAGAACTCGGAAGTGCCTGCGCTGTGGGAAGAGTCGGATCCTCGCTACATCAAGGA
CTCGGCGGAAGTGCGCTTGCGCTCGTTCTCCACCAAGGTACGCAACATATGTATATCGCAAGGCTTGCTTGCTACGTCCATTCAACTAATCACATGGCGT
TTGCTGCACAGGTGCACAAGGTCGATGCGATGGTAGCCTACAAGAACCCTGAAGCTGACATCTAACCACCGCAGGAATGGCATCTTGATTAGCGGGTGGC
AACTGCGCGTCTACTTATTGCTTCTTGTCCTTCTTTTCAAAACGCGACAGAACGGTCTCGATGTCCTTGTTGAATGCATCTTTGCTGAAATAGCCGTCCT
TGTCGAAGTAGCGGCCAACATACAGCTCCACCTTTTTGGGTGTGTCCTTCGCGTCACCGTGGTGGATGCTGAGAGAATAGTGCGACTCTGTGTACGGAAA
CGATGTCCGGACCAAAATGGTCTTACCCGCTGAACCCTGCAACAAATCCACACGTACAAAGGTTAGCATCTCTACCGGCAGTACAATCCTTCTAGGGCAA
GCTCACCGTTCGCGTCATCCGCAAGAGGACGTCCTTCTCGATGAACGTGGTGTAACCGAACAGAAGCGCGTGGATGAAGAAAAACCTAGTCATGTCCACG
ATAAACAACTCTTAGCATCGCGCAGTAACACTAGCGCCATACAGATGCATTCAAGCCCATTCACACTCACGCGCCGACGCAGGAGTAGATGAGCACGTGC
TCGGGAATCGCGGGATGCTTGAAGAAGTGCGACACGGCCGCAATGATCGTCGCCAGCAGCATGAACAGCAGCTTGGCGTTGTCCCATCCGTAGTGCAACT
TGAATGTGTCTTTCCCCTGGAAAAACTCCACGATGGTGTCGTCCAGCAGGTTCTTGACTGCGTTCTGGTCGCCCGTCTCGATGTGCAGATCTGCGGTTCT
CGCTTCAGTAGGCTGCCAGCGACTCTAGTACCAGCTGAAATAGTACGTACCGTTCAGCACCATCTCGTCCTCCGAGTCCTTGCGGTCCGGCGCGGCGGTG
CTGCTCGAGGCGCCCATGCTGAGCTGCTTGCTGTGGGTCGACTGCGGTGATGTGGCACTGCGCCAGATCCCGGTGCGAGTA