Description :
From Genome Similarity Track
Location :
Scaffold_962:3770- 10377
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_962-snap-gene-0.1Reverse transcriptase

Sequence
6607 bases(100 bases per row)
CAAGTCGGACGAGGAGAAGGCGTGACGGAAGAAATGGCGGAGCAAGTCCGGTCGATCATCTGGGCTAAGCGCGAGTACCTAATGGGAAAGGGGAATGCGC
TGCCACTGCCGGCTAGAGGCGTCGTCTGCGATATCGACGTCGGCAATGCTCGGCCGGTCGCGCAACAGTGCCGGAAGGTGCCGCCCAAGTTTGTCGACCG
CTTGTATGAAGTGCTCAAGGACCTGCTGCAAGTCGGATTTATCGCGCCGTCTACGTCTCAATGGGCCTCCCCGATAGTCATCGTGCTCAAGAAGAATGGG
GTGGATATCCGCCTTTGTATTGACTATCGCGTGGTGAACAGCCTTACGAAGCTGATGGTGTATCCGATGCCTGTGGTGCATGATCTCTTGGAGAATCTTG
GGGCGTTGCGCTGGTTGTGCTCGCTGGATATGGCGAGCGGCTTCTGGGTCGTCCGAATGACTGCGCGGGCGAGGGAGGTCTCGGCGTTCATCACACCTTT
CGGTTTGTTCGAGTGGACTCGGATGCCGTTCGGACTAAAAAACGCCCCGCAGATCTACCAGCGGCTGCTGGACAACGCGCTGTATGGCTACTTGAAGCTG
ACGCCCAAGCATCTGCAGGAGGAGGAAGCGGATGTGCTCGTCGACGTCGAACCGGCAGGTAACGAGACAAGACCAGCAATCGGCAGAAGATCGTATATTG
ACGACATTCTCTTCGGAGGGAATACCTGGTCGGAGATGTGCGAGAAGCTTGAGCGCCTGATGGACGCGTGCGAACGCTGGGGCCTTTCGATCAGCTTGCC
CAAAAGCGAGTTCGGTATGAAGAAAGTCGACTATCTGAGTCACCGTGTGTCGGCCGACGGAATCGAGGCGAAGCCGAAGAACTTGGACGAGCTCGTGCAG
CTCGAATTCCCGCGTACCGTGAAGGGAATCCAGTCGTTTCTGGGATCTCTGAACTACTACCACCGTTTCATTGAGCACTTCGGCGTGTACGCGGCTGCCC
TCTACGAGGTTACCCCNNNNNNNNNNNNTGCCGATCTCGCCCAGGAAGCAGAGCAGCCTGGTTTTTTGGCCGCGGCGAAGAAGGCGTTCGAGGCATTGAA
GCAGAAGCTGGTCGACGCGCCGCTGTTGCGCCACTTCGACGAAACGAAGCAGGTGAATGTCACGGTCTACGCGAACGGGTGGGCGATCGCTGCGACGCTT
CTCCAAGCGCATGATGGTCATTTGATGCCAGTTCGGTTTTTCAGTCGCGTGTTGAAGCCTCACGAGATCAAGTTCAGCCCAGCCGAACACGAGGTGCTTG
CGCTACTGCATGTGCTGGCCGGCGCCGCCGTACACCTAGCAGGTAGGGAGATCCACGTGCTCACCAGGCACTCGACGCTCGCTTGGCTCTTCCAGGCAAA
GGGCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGCGGCTTGAGAAGTGGGCGACCATGCTCAGCCCCTGGTCGTTGGTGATCCGCCGAGCGGTC
AAGGGTGAGGACGACTTGACCGGACTGCTGGCGGCCGCGATAGGACCATGCGATCGACTCGACGAGATGCTGCACGAGATCCAGCCACGGAAGAAGCACA
CACGTGACGTACGTTACCGCGCACCGCTGCCGGCGCTACGAGATGGAGAAGAAGCCTGGGCCGTATCTTTCGATGGATCGGCGAAGCCAAAACGGTCAGG
CGCGAGCTGCTCGGCCGTGCTGTGGCACCTGCCGTCCTGGAAGGTGAAGGCGGCCGCGTCATGGTATTGGGTCGATGGTACGGTCAACGAAGCGGAGTAC
AGAGGCGCGATCAAGGCGTTCGAGCTCGCTGTGTCGCATGGACTCGACGAAGTAATCGTCTTCGGGGATTCGCGGATCATAATCCAGCAGCTGCGCGGAG
AGATCGAGTGCCGGACACCGGCGCTGCAGGTGCTTCATGCGAAGGCGCTTGCCGTGTTGGCCAAGTTCAAGCGCGCCCACCTGGTTCATGTCAAGCGAGA
CTTCAATGCCGCCGCTGATCTCATCACGGGCACGGCGCTGCAGCGCACCGCTGGCGAGGTGGTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNCTTCGCGGATCTAGAGACCGTCAACAGGCTGCATGAGGTGTTCAACAATGTCGAGACCGCCGAGATTGCTCCGGCCGTGCTGGTGAC
GACTCGCGCACAGCGCCGCGAGGCGGAAGCGCAGAGTGGTGCTCGCGACACGCCGGCCCGTGTTCAAGATGACGGAGAAGCTGACCAAGACGCCCACGCA
GATATGACGACTAATCAGCTGCCGCGCGATGATGAGTCCGAGGGACCCGGGCCCGACCCAGCGCATCTTCCCGAACTGCAAGGCGGGGGTAGACAGGGTG
ATCACTCATCATCGGTCGACCGGTGTATAGACAGGCCGGTATCAGCTGCACATGATGACGTGACGACCGGGCGTCAACGAGATGAGACAGGGAACGGTGA
TGACGGCGCACCCGAACCGGCTACTCCCGAGGTGGTCCGACTACTCAGAGCGGAACGGATACGCGCCGCCCAAGTTGAAGAATCATGGGCGCGGCGACTT
AAGCTGTATCTGCGCAATGATGTCGCCGAACTCGACGAGCATCAAGTACGGACATGCGCCAAGATCGCGCACCTGTACGAGGTCGTCGACGACTTGCTGT
ATTATGTCGGCTCGAAGAACTCGCGCGATGGTCAGGGGCGTGAGCCGCACCTTCGACTCGTTGTGCCGGCGACACTTTGCACCGAAGTGCTCCACCACTA
CCACGCGAGTCTCTCGGGCGGCCACCAGGGGATCAGCCGCACATACGAGAAGGTTCGCCGGCATCTCTTCTGGCAAGGGCAGTATGAGGACGTCAGGAAG
TACGTGCAGGCGTGTCCGGATTGTCAGTCTGGAAAGGGGGAACCGCGGTTCAGCGGTGGCTCACCTGGGAACGTTGTCGGGACACGACCATTTCAGGTGA
TCGGGATGGACCACGTGCCATCTCTTCCACGATCGTATCGCGGCAACTCCGAGCTGCTCGTCTGGGTGGACCATCACAGCGGTTTCATCGTGGTCTCGGC
CAACCCTTCACGTGAAGCACAAACGGTCGCGGAGGCGTATGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAC
AGAGAGAATGGTGCAGACCGTGATGAGAGCTGTGAAGCTTTACGTGGCCGACCCGAATCAGCGTGACTGGGACGAGTACGCCGAGCGCCTGGTGTTCGCG
ATCAATACCTCGTTCGATCGAGTACGACAAGAGATCCCGTTCTACCTAGTCCACGGGTGGGAGCCGCGCACTACTCTCGAGGTCGGCCTGCCAACCGGGA
CCGACGATGGACGCCACGCCGAGGCCAAGAGATGGCGGATCGGCGCGCAAGTCCAGTATCGCCGAGCGAGAGAAGAGGCAAACCGCCTGCTGCAAGAGGC
CGTCGACGAGCGAATCGACATCAAGGACGGAGATCGAGTGTGGCTATTCATCAACCAGGCGCGACCGGGATATGCGAAGAAGCTCGCGCATCTGTGGCAC
GGGCCGTTCAGGGTGTTGGAACGGCCGGCCGGCCATCTCGTGAAGTTAGAAGTCGACGGAACGAACTATAGGTTCTACCCGCTCGTGCACGTGTCCAGAC
TCAAGCTTTGGAAGGAGTACATCGACCGGCCGAGTGTCGAGCTGGAGGTGGCGGCTGACGCGCGCTTCGATTTTGACGAGGCGCTGCTGCCTGAGGACTC
GTTCGCACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCGCCAGGGGCGGT
CTGTTCGTGAGTACCAAGTCCGATGGGTCGGCTATGAAGATCTCGACTGGGTGGCCGAAGAGGACCTGAACGCGCCGAGTCTACTCGCCGAATACGAACA
GCAGCTGCGGTCACGAGGACGCTTTGCCGTCATGGAGACGGAGGATGGCTAGCCTGCGTGCAGGTGGGACCGGTTCGCGGGAGGCACGAACTGGAGCGAC
GGGGTGGAGAAGGCGAGCGAGCGGCTTTGGTGGTCATCGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTGGGGGCCGCCGGAATGTGGCCCGCGGGAGGCGCGGGTTCACGGAGGA
ATGGGTTAGTGAAGTGAGGCGGACGAGTCGTTGGCTGCAGCAGGCCGACTGACTGGGGACTGCATCAAAGACCGATGGGAGGCATCGGTTCGGGTGGAAG
GTTTATGTTTTGTGACGTGTGAAGGGCGAACGTGTCGGTCAGCGAGAGGCATCAGAGCGCGGTGAATGGAGACAATGGAATTCGTCTGTGATACTCGCCG
TCCTGGCTTGTAGCCGACCAGCACGGGTCGCCTGCGAAAACAAGGAATCGACAGACTCAAGTGAAGGCTTGAAGTGAATGCAAGGTATGAAGAGGTGTCC
ACAAGCAGTTAACTGAAGGAGAGCTACGTGTATGGAGGACGCGGGAGCATCGACCCTAACGTGTCGACGTCGACGGCTTGGCAGAAGGAGATGACTTGGA
CGACGAGTTTTCGGTCGCCTTGGGTCGCGAGACAGCAGAAGCCTGATGCGAGGCGCTCGCGCTCACCCGCGGTCGCTTCTCCATCGCTCGAGGGGAGGCC
GACTGATGTTGACGTTTCCGTTCGGTCGAAGACACAGGTAGACTGGACTCAGACGTTCGGTCGATCTCCTCGTCATCCGACTTGTCATCCTGATTGTTGT
CGCTGTCATGACTGCTCGCGTCCTCGTCGCCTCCGCTCTGGTCGAATTGCTCAGCTATATCATCCAGGTCACTGTCGACTTCGTCTTCAGGGTCGGCCAC
CGACTCTTCGTCCCCGGCGTTACGTCCACTTGAACGAGTGGTTCGAACAGGCTCGCGAGATGTCGTCGAGCGGCCGTGAGTTTCCTTTTCCATCTCAGAC
TCCGACTCTTCAATCCGACGCGGCCCCCTCCGAGTTCTCTTCTTCGACTTGGCAGGCGATCGGGTCTTGACCGAGGGTTGTCCGAGTGCATCGGGCACCT
TGCTGGCGGCCATGAGAGCCAACTGATCGGCCGAAGGGGAATAGGGAGACTTCGGGTCGGAGAATTTCATCAGCAAGCGACTGCGGTGCGGGGCGCTCGG
GTGCTGAGGCGCAGTGGAAGGAGGTTGTTGGTCCCTCGGGATATCCTTCGGGCTACGGAAGTAAAGCCGAGACGGTTCGTCGCGATAGAGCTGGTCAACG
AACACGTCGAGTTCTTCATCCAACGGCGGCACCAGGGGTACCACGCCGAAGGCGGGAGGCCAGTAGAGAAACGGATCCAGCAGGAAGTCGGCGTCGACGT
GGCCGTCGAGGAAGAGTTGGCGGATTCGATCGAGGTGGAGCGACCACGGTTTGGTAAACTCTGAGTTCAGCTTGCGGCGTCGAGCGCTCAGCTGACCGCG
GAGCTTGTAGCGCTCCTTCTCTTTCGCGGACGAGCTCTTGGTCGGGGGCTTGAGCGGCTCGATCAGCAAGAAGTTGGCACGCTCCCAGAGTGGACGCATC
TTCAGTCGATACAAGTTGCAAGTGGCACGGTAAAAGCCAGAAAACTTTGGGTCGCTCGGGTCGAACGTCAGCGGGTTTGGCGGGTTCTCCAAGACCGTCC
ACGGCTCTTGCTCGTAAAGGCTGACCGCCTCCTCCAANNNNNNNNNNNNNNNNNNNNNNNCGACGCGTACCGACCACCAACGGCTTGGATGATGCCCTCG
TACTCGTTCGGCAGGGGCGTTTTCACCTCGTGCATGTGAAGCTGTAGCTGCCAAGCCACCATGCGGAGCCGCCCGATCCCCACCGGGAAGTGCCATGNNN
NNNNNNNACAGTGGCCACGGTCGACCGCGAGCCTTCGTCTCAAGCTGCTTGAACTTCAGGCGAGCGTCGTTGCGCAGTCTGTCAAAGCCGGCGTTCTTCA
GCGACTTCCCCTTGCCAGGTGAAACCTCTTTCCGCTTGCCTTTCGTGCGAGAGGGCAGAGGGACTAGTGGACCCTCTCCGCGTGACTTCCGCACGGTCGA
CTGGGGCGAGCCTACAATACTCGCATCAGATCCGGTGNNNNNNNNNNNNNNNNNNNNNNNNNATCGCCGGTGGATCCGAGGCCGATTCATCAACCCGAGT
GGTCGCAGATGGGGGCAGCTCGGACGAAGCGTGTGAGGTGGCGTCGGTCTCACCGGTAATCGGTCGCAGCGTACCAGAACTGATCAGCTGCGTGAAGAGA
TCGTCGTCCGGAGATGATGTGAGCGCGTTCAGAAGTGTACCGCGGAGTGCCTCGACGTCGAGTGGCTGACGCTCAATGACTGTCCTGACCGCTTCGAGAA
GGTGCCG