Description :
From Genome Similarity Track
Location :
Scaffold_1287:377- 9254
Transcript NameFunction/comments
Phyta_totarag12631hypothetical protein
Phyta_totarag12632hypothetical protein
Phyta_totarag12633hypothetical protein

Sequence
8877 bases(100 bases per row)
GGCTCTTCTGCGTATGCGTCGCCCGCGTGTCCGGTGTGTGCCCGAGTCGCGTCGGCGTCAACTGTGCATCTTGACCGGTCACATCCTGATCTTGCGGTTG
TGCACGCGTCGCTTCAAGCCACGCTCACCGCGCTGCAAACTGTCGAAGTCGCGGTCCGTCGGGAGACGATTttacagcagctgcaggatgaGCACGTTGA
GTTGCAACGGACCCACACTGCCTCGCTCCGCCACGCTggcgatctccaccagcagatCTCGTCTGCGGCTGCCGCCGCGGTTCCGTTCGCGCGTTACTGT
CAAGATCGCCATAATCGGCTGTTCGGGGAGTTCCAAAACTTGAGCACCCATCTCGCGGAGCGGTCGGTAGTCGTGGGGAGattggaagaggagatcgcCT
CCCTAACATCCTCCTAGGCAGAGCAGGTCCGGGCTCGTACAGCCTCTGCAGCCATGATCCCCCAGCTCCGCACTCAAGTCGCCGACCTTGAAGCTCAGCT
CGCCGCTGTGACATCACATCCTGATCTTGGGCCCCCAAGTCTGGCTCGTCGACTGCAATCTCAAGATCAGGCTCTGTCTCAGGCCCAAGCTGATCGTCGT
GCGGCCGAACTTCGTTGCGCGGCACTAGAGAGATTGGCGAAATCCTTGGAGGACGCCACCGTACGTCTCAAACGACAGGTTGGCGCCCAAACTCGCCGGA
TAGGGTGTCTTCAGGCCGAACAGGCCGACATCCAAGCTTGACGAACCAAGGTTCAAGTAGAGTTCGACACGCTCGCGGCGAACCATCGTGCTCAGACCGA
CCGTCTGCAACAAGCACGGGCTGATCTTCGATCTCGAGAGGCCCACATTGCGTCTATGCGGTCGACCATCGCTCGCCTCGAGCACCAGGTATCTCGGTGG
CGTGGCGCTCATGCCGCTTCCCAGGCAGCCACGACTCCATTACGTGATGAGATCGAAGTCCTTCGCCGAGATCACGACGCGACCAGCCACTCCTACGACA
CCCTCTACAGCCACTATACGGACGCGTATTCCCGTTTCTCCGCTGTGGCGATTGCTATGGGGCAGTCAGTAGAGTTACCGTCGCCTGTGACGTTCAAGCG
TGATCGCCCTATAAGTGGAGCGGCTTCCGATCTGTCGGGTCGGTCTCAGAAGGTCCACAAAGTTACACCTGGTTCCACGGCCCCTCGCGATCACCGTTCg
cgatctccagcgtcgcgatctccatctccgCGATCTCCGGTTCCACAATCGCCCCTTGCGAGTCCTGCCCACTCAAAGCGAGCAAGCGCGGACGAGGTCG
ACCATCCTGTTGACATAGTGGACCCTGAGCTTGAGGCAGCGTTCGAGCTcgatgatgaggacgatCTGGCCGTCTTGGCCGCGCTGTCTCGCTCTCGTTC
GGAGCAACGACGGAACAGCTTGTCTGACGCCGGCTCCGCCTCCCACCCGATTGACATgagtggagctggagaaccaGGTGACCCGTCTGGGGGCGACAAT
GCGGCTAGCAATTCTTCAGGCAATTCTTCGGACTCCGAGTCCGATCGTGATGAGCCTGCTGCTAACAGTGACGcggagatcgacgatcgGGATGATGGTG
CCGGCGAGGGTGATCTCGTAGATCTCCCCGATGACGGTGTCCGTCTGATTCCAGCTACCGCGACTGTACCTCGATCTCAGTGGATCCCAAGCTTCAGCTG
TCAACGCCTTTTTCGAGAATCGGATGTCGTTCCCTAGGACAAGGATGTGATCAGCCAGCTCCAGATCTCAACTCTCCGGATTGATGACTTGAGCGATCTC
CTCCTGGTCGTCTCGGAGTGGTTGTTCCCTGTCTGAGatcgtcagcagcgtccCCGCACCTCAGCCTTCGAGCAGCTGATCACAGGTGCCGCCGTCAACG
CGTTGATGGACACTTCCCCATAGGCCGTGTTGGCGTCGACTGAGGGTCCCTTCACCTTCATGTTGGATTTCATGCCTGAGTCCTTCTGTAAGAGCTACCT
GGAGTTTGAAGAACGTCACCTCCAGGCATTGTGGGAATCGCTCCACTTCTTGCCGATCACCGGGGCTATGTGCCAGGTTGAGCCTGACTTGGCGGCGTAT
CATGAAGCTCGTCATCAGCGCAGAAGTCGCGCTGGCGTGGCGTGGAAGCGATTCCTTCACCAAGTGTTGCAGGTGATGTGTCTCCGTCGGTGTGATCTTG
ACATCCTGCTGGATCCTTTCTTCCTTCACCTCCCCAAGTCGCGGGCTCCGATCAGGTGGTTTCCCCGCTTGGAGGGAAATGCCGCAACCTTGATCGATGC
TCTGGAGATCGTCGACCGCGATGTTCCGTGGCGCAACCAATTTCGTGACTGCCCTGACGATCACCCGGCGAAGCAGATTAGCCGTCTCGAGAATAAGTTC
GTGCCACCCCTGCGGCGGTCGTCGTAAGTCGTTCTACACGTCGCAATTCTCTTAATACATTTCGGACTTCGATCTCGATTCCTCTTTGATCTTGATGCTT
CTGATCTTCGTCCTTATCCACCCGATCTTGATACTCTCCTATGAGTCTTTTTTCATTGTCATATAATGCCTTCGGGCGCACGAGCCACGCAGGTGGCGCA
CGTCCTTTGATCTTGAACAGTCTGATTCCTTGACCCAAATCCCGGTAGTTGGGTCAACCGGTCAGTAGTTGACCCGAATCGAGCTCGTTGGGTCAACCGT
TCATCTGTCAGATCCACGCACTTGTACACATGTACCTCTTCCTCCTGATCTTGTGACCTTCTCACAAACCCTTCATCCTTAGAGACCACCTCATCCACGA
CCTCCCATTCCTCCTGATCTTGTCGCCTCCCCACAGACCCTTCTTCCAACTCCTCGCAGAGTGGCATGTCCACCTGCGATCTCGCAATCTTACTGCTGCT
CATGAGACTGCATGACGCTGAACCGGTTGCAGTTGGACTGCTCGCGCAGATAATCACACATCTGTGCTCCACAATTGAGATCAGCTTCATCAACCCACGT
GAGCTCCTCATAGCCTTTCCAGTGCACCAAGAATTCTCGCAACAGTCGCCCATACCGCGTGCGACGACCAGATCGCATATCCACAATCTTGTCCACCTCG
AATTCACCATCCTCTAGCTCGTTCTCCCAACTGTCCTcagacagcagcgcttcgtcAAAGTCGAATCGATCTTGATCTCGGACGACTAGATCCATTCGTG
GGCGGTCGGGGAACCGTCGgagcaacttcagcttcgacacaTGCACCACTGGGAACAACCGGTACTCTGTCCCAGTTATTTCGAGTCGAACAGCGTACTC
gtccaccatctccaccactcTGAACGGCCCATGCCACATATGCGCCAACTTGCGTGCGTAACcttccttcaccttgtcgaGGTATTGCCAGACTTGAGAA
CCGGTTTGGACCTCATGCGGACGTACGTCGTGGTTGTGTCGGTCAGCTCGATCCTGGATGGTTTCTCTCAATTGGTCGTTCACTTGCTTCCGCGCTTGTT
GATAGAGTTTCTGGATGTGGTATCGCCATCTCCTCGGGTCACGATCTCGGTGACGCGTCGATCCCAGTGGTATCATCGCTTCCAGTGTAGATCGCGGGTC
CCAGCCATGAGCCAGATAGAAGGGTGTATTTCCACGcactcgatcttgagcggtgttgatggcgaacgTCAGGCATTCCGCATACTCCTCACAATCCTTA
TGGTCTACATCTGCGACGTACATCTTTAACGCCCGAGCTAGTGTCTGCACCATCCGCTCAGCCGTTCCGTTGGCCTGTGGGCGGTACGCCATCGTTGCGT
GCTGTTTTTGGCCGACAATCTTATTGAACGATCTAAAGAAGTTCGACATAAACCCGGGTTCTCGATCATGGCGGATTGCTTCACTCGCGCCGAAACGTCG
GAAAACGCACTCTTCCTAGTTCTCCGCAATTGTCTGTGCCGTCCTGGAGGCGCTAGCTTTGGCGATTACAAATCCGGTGAAGAGGTTGACCCAGATCAGC
AACTCGGTATTGCCCTTATGAGATCGAGGTAACGATGGGATGTGATCCATCGCGATGATCTGAAACGGGTAGGCCGCCTGCAAATTACCCGGTGATTCGC
CTCGGATAACAGGTCTTCCCTTCCCCGTCTCACAATCCACATATCGCCTCACATATCGCTGCACTCTAAAGATTCCTCTCCAGTGAAAATGTGCTCACAG
TCGCTGGTAAGTCCGTCCGACTACTTGATGTCCTCCTTCCAAGCTGACGTGGTAATGATGCAGGAAATCCTTCTGCAGGGTCTCCGGGACGACCAATCGA
GCGATAAGATCACGATCTTGACGCGACTGCGTTGATGGCGGGCAGTAGAAAAGCAACCCATCTTCGTCGATTTCATAGTCTTCCGCGATCTTGACGCAGG
TTTTTGCTTCTGTCGAGCTGAGATCTTGTACGTCCCCTCGCAGGTAGTTCTTGAGATCGCCAATCCATTTTTCTTCGTTGTGCGCTCGAAGAACACGTTC
GGCCCTCAACTGCTGGACGATCTCCTCATTCAGGACTTCGGGACTGCGTCGCTTGCGTGATCTGGTTACAGCCGAGATCTTCATGGTAGAATTCCTCGTT
TGTGGaaccagcaacttgctctgTCAATTTAGTGTCCTCAAATCTTGGCGCTCGATCTCAGTCGTAACCACGTCACCCCCTTCACGTTGGAGCGCCGCAC
CGGCTAGTCGGTCGGCACTTTGGTTCCAGTCTCTCTTCATTTGGAGGAACTCGTGGCGCGGCCAAGATCGCAGACGTTCCATCGCTCTCTCACGCAACAA
GTTTAGCCCTGGTGCTTTACACTCGATTTCGCCGCGCATTTGTCGAATCACCAAATTTGAATGTCCACATATAATCAGCCGTCCCCTGTCCAAGTTGGAC
AGGAGATCGAAACACAGGAGCAAACTCCGCCTCATTTACGGTAAGATTGACCTTGTACTCAGACGTGGCCAAGATCACTGTCCATTCTGGTAGACACCAC
ACAATTGCTCCATAcactcctccacctcgctTCGCACGTGCCGATCCGTCCAAACTTACTACAAACAGCTTTGCTTCGGGTTCCACCGTGGGAGGGGGCA
TCGAGATCACTTGACGAGGTTCCTTTCGTGGTGCGATCGCCGTCAAGATcgcgtcaacttcttctcggGGAGTGATGCTTGCCGCTACCACACCCAAGAT
TTCATCCTCGCCCTTCGTGCACTTGACGATCTCCAACGTCCAGCTAGAAAGAAGTGCGGCCCACCTGCCCAAGCATCCCTGCAAGCCCGATGATTGAACC
AGCCAGGCTAACGTGGAATGCCGAGTTAACACCTTGATTGGTCGGGTCACCAGTTGGGTGTAACATGAATTCAGCATCctgagcagcgccagcacttCTT
TGTTCACGATACCGTAATTGATCTCGTTAGGCTTCAACGTGCGACTGGTAAATGTCACCGGCTTGTATATCCCGTCATGCTCCTGCACCAAAGCTGCCGA
GATCGCCCACTTACTCGCGTAGACTATGATCACCGGTCGTCGGTGGGTCGAAGTGTTGAAGGATAGGTGCTGTAGCAATTATATTCTTCAGGGTAGCAAT
TGCCACACCCACCCGGTCCCATTTCCCTCTTCGTTGGGTTGAGCTTCGTCTTTGTTTCCCAGATCGCGCCTGGGCGCCTTCAGGTCACGCTTGGATTTCC
TCGAGATCTCGTAAAAGTCGGCCTCCCGGAGTTCATATAAGACCGACGCGTCGATCGCTAGATCTTCAATGAAGCGGCTGTAATAGTTGAGGCTGCCCAA
GAAAGACTGCATCGATCTCAATGTTGTGGGGAACGGTAGATCAACCAACGACGACAGGTCCTTCGGGTGAGCCTCCAAACCCTCGATCGGTATTTGATGT
CCGAGGTAGTCCACTTTTCGCAAGCCCCAAAAGCTCTTGGCGACGCTGATCGACAAATTCCACTGATCGCACGcgtccagcaacttgtcgaCCTTGGCAC
ATAATTTATCCCACGTATTGGACGTCACCAGGATATCGTCGATATAAGATCGGCGACCGATAACAGACGATTCCTTCTCCGTGTCTGACACTCCCTCCTT
GAACAGGTCGATCTGGCGAGGACGGCCAGGGTCGTTCGTAATCTTGAGGAAGCCGTACAGAGCGTTATCCAACAGTCTCTGGTAGATCTGCGGCGCGTTC
TTCAATCCGAAGGCCATTCGGTTCCACTCAAACAGGCCAAACGGAGTAATGAACGCTGAGGTCGCGCGGGCCCGATCCGTCATAGACACGACCCAAAACC
CACTGGCCATGTCTAGTGAACAGTACCAAAACATCTTGTCGAGATCGTCGAGCAGATCGATGATCAGCGGCATGGGGTACACCATCAGTCGCGTCAGGCT
GTTGACCAACCGATAATCGATGCATATCCTGATGTCAATTCCGCTCATCTTGATGATGATCACAATCGGTGAGACCCAGGGTGAAGTTGAGTGTCGGGTG
ATCTCCGCAGACAGCAGGCCCTTGATCAGCTGAAACAATTTTTCGCGGAACTGCAGGACGACTTTTCGCACCCGCTGGGAGACGGGTTTAGCACATTCCA
CGTCTATGTCGCATATCGCTCCTTTCGCAGCTGGCGGTAAGGCGTTACCTTTCCCAATTAAGAGATGTCGGCGACGCCAGATAATCTGTCGTAGTCGTTC
AATCTCCTCCGGCGTGTTGTCGCTGAGATCACCTACCTGAATGTCTTCTATCTTGGCTTCCTCTGTCATTGCCGTAATTTCTGGTAACACTGCCATCTGC
ccttcgacgtcttcagtGAACAACTCCCTTCCTTCCTTGAAGCATACTTGCTCATCTTCGACAGAATACACCGGCCTTGAATGTGTGCATGTCCCGTAAT
CCGTCGCGGGTGCATGTTTACTCCCCGAGTAATCCTTGGTGGGTGTATGTTTACGCTTCTCGAGATCATGATCTGGGGTCACTAGATCTTTTGCGTTGTC
GCCTCTGTCAACGTGCGACACATCCTCACCTGACATATATGCGTCCCTTCTCTTAACTGGCGACGAGTCACAGTCCTGCCGCAATCCTTCTGCCTTTCCG
ATATCCGGTAAATCCGCATCTTGATCTCTGCAATCGGCAGTATGCATCACCTTTTCTGCACCGCCGACTGGATTCTTGGTACACTCATCAGAGTTGACGC
GCCCTCTCTCAGCTGGCAACCGGTCGGAATCTCGACAGTTTTCTTCCACCCTCGGGATGTCCGTTCGCAGAGCTCGTCGGTCGCATTTGACGTCGATCCT
CTCCTCATCGCTCTCTGCAGTCACCACTGCCAGCACCGGCTGGCTCAGCGGCCGAGGCAAGACCGCCGTGGGTGCCTTGTACTGCGGTCGTTCGACGGCG
GGCCCTTGgggttctgcagcagcttggaggtcgtcatcttcgtcggtgGTCGCCTGGTACGCGAGGTTCTGCTATTCGGCGTACTTCCGCGACCCTACGG
AGGCGTATCCCGGTAAACGTGGTACGCGATCTCCAGCCAGCCACATCCCGATATGCGTGCTCTGACCTAGCACTAACTTGCGACTGCTCACGTTTGTCAA
CTCCAGATAGAGCGTCCTGTCTGGGCAAGTCGTTAGTGTAGGCATACATCGGTCCCCACGGGTCAACCACACCTTCTGTCGCTCGGTTTTGTTCGGATGT
AGCTTCACTTCCAACGATCTCCCGACCTCGATGTAGAGAGCTTCCCTCAAGATCACCGGCTTAACGCGATCCCCATAGAGCGGACGCCTGCCGGACAGTT
GGATACGCACTTCATCGGGAATACAAATCGTGCCGTCAGCGAGATCAAGGCGAATTCCAGCGGGGGCCATGAAGTCCATACCGATAATTACGTCTTGTCC
ACTGGTAGGTGGGCCCACCCACGCATCGAAAAAGTAGATCAATGATCCAGCGAGAGTGATCTTAAGTCTGGTACGCCCATCCGCAATATATGGAGTTTTC
CCAACACCTTCACGCTCCAATGTCTGACTTTCGTCAATGTAGCACCCAACCTTACGACCAAATGCGGTGTCGATGATAGACACCTCGGCGCCACTGTCAA
ACAGCATGGTTGCTTTTTCGTTGTTGATCTTCCCCATGGCTTTCGCTTGTTTGAACTTCTTGTCAGGCACGTGGTACTTCCAGTAACCACGCGACCCTCC
TGGCAAAATGTCCAAAGCCATCATCACCTTCGATCTTGAATATTCATCGATCTTGTGAAGACTTGATACGGCGGAGGGTAGGTTTTCCATGAAGATCACA
TGTATTGTCGCTCGGGTTCATCAGCTTGCTAACTGTTGACTCCTCTTATTTTTCGACATATGCATAGACACAATATCTAGAACGCTCGTCTCGTACCGGG
TTCAAAACCGGCGAGCGTCCTAGTTTAACATCTTTTCGGCCGTTTCCGGCAGCATGCCTGCGTGCTTGGTGGGGTTGAACCACTGACGGATCAAGTTGTA
AAACTCTTCCATCGGGCACTTGTCGGCATCGTGGATTTCCCGCACGCCTtgcacacgaagaagcagcgctcAGACGGATGCCCTCTCTTGCCGCACTTCT
CGCAGGTCAAGCGTCCCCAGCACCCAAGGTCGGTGTGTTTGCGCGATCCGCAGTGAAAACAGCGTTTGGGTGGCGTCCCTTCATCTGTCGATCTCGGGTG
GCGATCACGAGTCGCGTAACTTGAACGCTCACGATCTTGATCCGGCGGTCCCCGATCTTGCGGCTCTCCACGACCTCCAGTCGCTGCCAAGTATACCTTG
CGCAATCCGGCTTCGCCATCGGACCCGCTTAACACAGCTTCAGattcgctgctgtcgttggcCACGTGGATCGCTCG