Description :
From Genome Similarity Track
Location :
Scaffold_1572:377- 3937
Sequence
3560 bases(100 bases per row)
CGTAACGAGATCCTGATGTTCGGCTTCTCCCTCCACTTCGACACCACATTGATCCCGTAAAGCGGCACTGGCCAAACTATCCGCACTGGCATTCCAATCT
CGCTTTGACATGTACCAACTCGTGATTCAACCAACCACGCAGGTGATCATCACTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTTGCAGTCAATCTCA
CCTCGCACCTGTCTAATTACCAAATTTGAATCCCCACAAATCACCAGCCTTTTTGGATCTTGTCCCTTTAGTAAATCCAAACCCAGAAGGAGTCCGTTAT
ACTCCGCCTCATTGACGGTGAGGCCTTCTGCGTAAGTGGATCTGGCTCGTACAACTTCCCATCCGGGCAGTCTCCACAGTATTGCACTGTATGCTCCTCC
TCCGCGTCGTACACGAGCGGATCCATCTAAACTCAGGACGTATAGATCCTCATCCACCTGTACCGTCGGGATCGGGATCTGGATCCGGCGTTTGGGTTCT
TTCTTAGGGGCGATCCTAGTCAGCGCCTCATCCATCTTAGCTCGAGGAGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACACT
TCACAATCTCCAGCGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGTAACCCGGCCGACTTGAACAGCCAGGCTAGCGTAGAGTGTCG
GGTCAGGATCCGGATGGATCTTCCCACCAGCAGGTTGTAATTCAGATCCAACACGCGCAGGAGCGCGAGTATCTCTTTCTCCACCGCTCCGTAGTTCAGT
TCATTCGGCTTCAGTATCCGGCTGACGAAGGTGACTGAATGACAGATCCCCTCATGTTCTTGAACCAGAACTGCTGAGACTGCCCAGTCGCTGGCATAAA
CTATTACCGTAGGTTGCCGTTCCGGATCGAAGTGACGGAGGATAGGCGTGGTCGCGATTCTGTTCCTCAGTTCCACGAATGCGTGTTGAGCTCGGATCCA
CCGAGATTCTGCCTGTTCCATGTTCTGATCCGTCGTCTCTATCCAGCCTGGATCCTCTCTCTGTTGGTCCCGGGGTGGATCCAGCTCCTGTTTCAGGTCC
TCTTCTGGCGTCCTACCACTTGGATCCCTTCGTGGATCCGGCATCTCCTGGGCCAGAGCTTGTTGGATTTTCATCTGGACAGCTGAAGTGGTCATCGCGG
CAAAATCTACCTCTCTCAATTCGTACCATACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGACTGTAGTAGTTTAAACTGCCCAAGAAAGATTGCAT
CGCCCGTAAACGACTGTGGAAGGACAAATCGGCTAATGAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCCCTGGAAACTCGATGGCCCAAGTACTCC
ACCTTGCGCATCCCCCAATAGCTCTTTACCACACTAATAGAGAGATTCCACTTAGTACACGCCTCCAGTAAGGACGTCACTCTCTCGCACAGCTGATCCC
ACGATTCCACCGGGATCAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACGGACGGGGTTCCAGAATCCCCTGGCTCCCCCGCTTCGAATGGATCCAC
TTCCGTATGGCCTTCCCCGGACCCACCTGTTTCGGACTCCGGTATTCGGGTGAATCCATAGAGGGCGTTATCGATCAGGCGTTGGTAGATCTGGGGTGCG
TTCTTCAATCCGAACGGTATCCGGTTCCACTCGAACAGGCCAAACGGGGTGATGAATGCGGATATTGCGCGAGCTCGATCCGTCATAGTAGCCACCCAGA
AACCACTGGCCATGTCTAGAGAACAGTACCAGAGTACTTTATCCAGATCTTCCAACAGCTCGTTGATTAGGGGCATCGGATACACCATCAATCGAGTCAG
ACCGTTAACCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACTGGGGATGCCCACGGGGACGTCGAGAAACTG
ATGATCTTGGCTTGCAGCAGGCCCTTAATCAGGTCCGATAGTTTTTCCCGGAACTGAGGTGCCACCTTCCGCACCCTCTGAGCGATCGGTTTCGCGTCGC
CGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAACGCATTACCTTTACCAATCAGCAGATGTCGGCTCTCCCAGATTCTCTGACGCAGACG
ATCCACTTCAGCAGGTTCATTCGCCCCCGGATCCACTTGGATATCATCAATCGTGACTTCTTCTGTGGTCAGTGGTACCTCCGGGATCACCGCCATGCCT
TCTCCCAGATCCTCGGCGTGTAGATCCCCGCCTTCACGGTAACAGACTTGCTCATCTCCGTCTTCGTAGGATCCACCATTGGATCCAAACACCGCGGCCC
TCTCTCGCCTGGCAGTCCTTCTATCTTCGGGGGTTCAGGTAACCTGGTATCAGGGAAACCACCAGTTGGATCCAGTTGGTCCTCTAACGAGTTTAAGCCC
GACAGTTCGGGTTTGACTAGTGTTGCCACTCTCGATAGGGATCCAGGCACTTTATCCAATGGAGAGCTTGGATCCACTTGTGGATCAGCGGGATCCGGCT
GCTCGGCTTTAGCCCTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTAAGGCCGACTCTGGGGATCGTCCCCCGTCCTGGATCCAACTTCCATTGCT
TGGATTTCAACCCGTCGATCCCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCTGAAAGCTCCACCT
CTGCGAGAGATTCGATCTCGGTAGTCGCTTCGTACACCAGATTCTGCCCATTTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGTCTAGGG
ATACCGTCCTTCGCCAACCTTCGTCCGATCTCCTCATAATGGTCCAGTAATAATCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGCGATCGACCTG
GTCCTTGGATTACGGTGGGAACCCATTTCTCGCCCCGAGTGACCCACAGTTTTTCATGTTCCACCCACTTTAACCGGTCTGGCAGCTCCCAAGTTTCCCC
GGGCTCGATCCAGGTGGTCTTATCCGCCCTTATGATCCTCATCTTCGCTCCATACAACGGCCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAA
CAAAGTGTCCCATCCGCCAGATCCAACCTCACTCCGGCTGGCACCATGAAATCCATCCCAAGGATGACGTCTTGACCAGCGAGATCCCCGACCCAAAATG
TCAAACCAATACACCAAACAACCTGCCAGCGTGATCTTAATTCGCGTTCTCCCGTTTGTACGGTATACGCCTTCACAAATCCCAACACAATCTTGGATCC
GACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCCAGTATAGACACCTCGGCACCACTATCTAGAAGTAGGATTGCTTTTTCATTGTT
GATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTA