Description :
From Genome Similarity Track
Location :
Scaffold_311:377- 1874
Transcript NameFunction/comments
Phyag_g4538hypothetical protein PHYSODRAFT_285374
Phyag_g4539hypothetical protein PHYSODRAFT_496342

Sequence
1497 bases(100 bases per row)
CTCCAACAACGCCTTAcgccttcttgttcacgtcCGGACGACGCTCCAGGTACAgtcgcagctcctccacctcctccaggtCCCGGTGGTACTTGTTCTG
CAGGTAGCCGCCCAGTCCAGCGCCTACACCCATGAACAGCACATGCTCCCATGGGTCTAATAGTATTAagaaacaaaaaaaaagaatAAAAAACACGTCG
GGCGTTAGTTCTTCTAGGGCTGGATAGAAGCAATATTGTTCCTGAAACAGTGGATAGAAAGCTATAATAACGAAGAGGGGGACACGTACGGCGCATGTAC
GGgaccttctgcagcacgttgctgccgagcttggTGGAGAGGCCCATGAGGGTGCCGACGGCGATGCCCGTGAAgcccattgctgctggtgatcaCTCGC
TCAGTTTTCCGTGGGTCTGCCCCTCAAGCAGCGGTCATAAATCGTTCGCACCagtgattggtcaaaattCTGTCTTTTGTGGTCCAGATTGCCCATGAAT
GTGTTCACACAAAAATTACGACGTAGCAAAATTGGACTATTCAATAATGTATCCATACAGATTTTGAGTCGCAGCAATTTGGACTAAAACGGTTGGCCAG
CCTGACCAACGAAAAGCTCCGATACGCACACCACTTGAGCGTCACCACCTTTTGCCCCgacacgacagcagcgatgagcGACAcggagagcagcaagaag
agcaactACGAGGAGCGCGTGAAGCACGTGTCGGTGATCGCCAAGCCGCtggccaccaagaagcagaccAAACACGCCTACAAGGTGGTCAAGAAGGCCA
CCAAGGTCAAGGGCATCAAGCGCGGCGTCAAGGAGGTGGTCAAGGGCATCCGCAAGGGCGACAAGGGCGTGTGCATCATCGCCGGAGACATCTCGCCGGT
TGACGTCATCTCGCACATCCCCGTGCTTTGCGAGGAGAACGACATTCCCTACATCTTCACTCCGTCCAAGGTGCGCAACGTTGATACACTCACTTGGCGA
TAACGCTTTGAGGCTGATCATTGGTGATTTATTTACTTCTGTGCAGGTGGATTTGGGCGCGTCGGCGCTTTCCAAGCGGCCCACGAGCTGCATATTGATC
ACGCCCAGCAAGCCTGGCTTCAACGCCCAGGAGGCCTACGACAAGCTCCTGGCGGACGTCAAGCAGGTGCAGCCGACGTATTAGATCGTTAGACGGCAGC
CAAGTTGTCTGCGTCATTATACATGTAGCACTTTATCATTCGTCTGTCTTGTCTTTCGAGATGCCGTTGTGCTTCCACATTGAGCCCTCGACTGCAGAAG
GATGACGAGCAGAGCTGCATCTTGAACGACATCCATGGTATGGTTGGTGCTAGGAGTACTAGCTTGTCTTGTAGCTACGCTTTTCTCATTACATACTACA
CCCTATCCAACACACGACAGCCGTGTGCAAGAGCTCCTGAACAACTTAACTAAAGTTGTATTGCACGCATGTACACTAAAACTTCAAGCactcctcc