Description :
From Genome Similarity Track
Location :
Scaffold_245:37697- 42308
Sequence
4611 bases(100 bases per row)
GAAAAGAAGGGGACATTCTCCTCCTGTGGATCAGAGAGGTGGAAATGGCCATGAACTCCGCTATGCTCCAGTCGGAGCAACAGCGAGTTGGGATGGATGT
ATCAAAACTTGGTGGTAGAGCCAGAGAATGAGCTCTCACTTGTAGCACGTTGGTAGTCGAATCTTTCCCCACATGGGATTTGTTGAAACAGCAAATATCC
CGGGTGTTTGCTCCGCCTCATCAGGCATACCGGGTGCGTTCTCGTTTCCTATCTGCCTGTCAGGGCAAAAAAGAACTATCGTACTATGTCCAGGAACTGA
GAACTCTAACCGCTGCCATGCAGCTTGATCCCTTATCAGAAATGGTTTTGGTTACCATCTTCATGAAGAGCCTTCGTACGGGCGTGGCTCGAACGGAAGT
ATTCCGGGTATACCCCACCTCCTTTGAGGCGGCTGTGGATATCGCGTTGAACGTTGAGTTCAACTTTAAGGCAGCCTATTTTGGCACCCATGGGTACAAC
CCAAACTCGGCGAACTTCTTTAGTTCATTCAATAGGCCGGAGAATATGGGCCTTAGTCTCGCCGAAACGAACGAAGAAGCAGAGCTTCGAGCTGTAGAAC
AGCATCGAAACATTCGACGATATTTCACGTGCGGAAGCACAAAGGAACTGCTACCTAATTTCCTTTTAAGCAGGGCACGCCAGGCTACTTCAAGTTGAAC
TCCCGCCGCTAACCAGAATTCTGGTACGGTGCGGGAAAACGTAGACTTTTAGTAAGTGCGAGGAGCCCTGCTGGGAAAGAACTAGGTTCTATTGAGTCCC
TAGAGGTAGTGGCGAACAAACATAGCCCCAAGGAGCCCCGTGCACTCTAACACGGGGCGTGAATACAAGCCAGGCTTGTTGGTCGCAAATGAGACTGTTA
AGGGCTTTGACAAACCCTGGTCGATTTTGATCGACTCCGGCGCATCCGGTAATTGTGTCAAACGATATTCCTTGAAGGGAATTCACGTTATGTTGAGGGC
TAGGAGCGCACAAGGATGATACGATCACTGTTCGCTTAGTGACAGGAACTCTAGCCACCACAGCCAAAGCTCCTGTGAACTTGGGTGTGAAGTTCTTCAG
TTTTGATAGTATCGAACACTGTTTAGTCCTTGATTTGGACTCGAGATATGATCTCATCCTTGGTATGGCCTGGATTGAGCGCCACGAACCATGGATTGAC
TGGAGGTCAAAAACATTAAGCGCAACGCGCACTGCCCCTAGCGGAGATTTGGAGAATCCTGAACCCACCTCTGCTAGGAATCAGAAGCGTTATTGGCGCG
AGTCACTGGCTGAAAATGTCAGTGTGCTGAACATCGGAATGTCAGAGTTAGTTGATTCTGACGATGTCAAAGACATGAGTATAGAGCAAAGCTCGATATG
TAATAGTGAAGCGTCCGCTAAGTGATAGTTGTTGTGGGAGCAACGTAATGAACTCTGAAAGCATTGTTGACCAAGCGTTAAGTCATCAAGGATTGAACCC
ATCAGATGAGCGTGGAGTGGCACGTAAGTACCCACTGAGTGACGTTGGCTGTGATAGCGACGCGCTAAATGTCAATATTGACATTGTTGGTGAAATATTA
AGGCATTCCGAGCCCGGCTCAGCGGATGCACGTGAAGTGGCACGTAATCCACGCGATGACGACGTCATGTCCCATGACTCGTCATCGGATGTCGATCGTG
ACATCAGCGCTAGGTTAGAGAAAATTACGTCTAATGATGATATCGATCAGAGAGATACTAGTCACAAAGCGTGTGCTTTGTCAACCAGTGATAATGACTT
TCAGCTGTATACACTCGTCAACGAAGTGACTGGTGCCTGTGATGGTACAATTAGCCTTGAGGCTATACCCTCGTTAAGTTCTCTTTTAGAACTCGAAGAA
TTGTCAGTCGATGAGTTTGATCATTCACTTAAGAATGGAGACCTTTCAGTGGTGGTAGTAATTCGACCCGACATCATAGAGTTAGGCCCTTCTTCACTTT
TGGATGAAGCCGTTCTGGAAGACACAAAAGCAGCACTCAGTGCGCGTAGTGGGTCATCCATATTGAAAGACCCTCATGATCTCTTTTATTCCTTAGTCAA
GGAATTTCAAGATGTGGTGTGCCACGACCCACCCTCGGTTCTACCTCCAGATAGAGGTGTCCGTCATGAAATTGACTTAGTTCCTGGGACCAAGTACTGT
GTCACACGACAGTGGCCCTTGCCCAAGGAGAAATGTGATATCATTGATGACTTCTTCGGTGCCAAGCACGAGGCAGAAATGGTACGTGAGAGTAAATCTC
CACATTCGACACCGACATTTTGTGGCAAAAAGTCGAGCGGCAAGTGGCATATTGCACATGCTTACAACAAGCTTAAAGCGGCTACTATTCCGGCACAGAC
ACCCATTCCTAGAAAGGACGTTCTTCAAAACAAAATGGTTGGTTGTACTAAGTATAGCGCACTCGACTTGGTCGATGGATATTATCAATTGCTCATGCGA
GTGAGTGATACACCGCGTACAGCAGTGATCACTCCGAGTGGTATGCTATGGGAATGGCTGGTGATGCCCCAGGGGATGTCTAATGCTTCTGCAACATTTA
ATCGACTGGTGACGCAACTTTTCTGTCCACATCGGGATTCCGCACGGACGTACTTCGATGACATTTTTGTCTATAGTCGTGCCGAACAAGGTCGGTCAAA
TGTTGACACCATGCTGACGCATTTCGGGCAATCAAAGAGAGTCTCCCCCATGCTCCCATTTTGGCGTTTCCAAATCCTGAGTACCATTTTAGTGTTGTCT
GCGATGCATCAGATTTTGCTATAGGTAGCGTCCTGTTACAAACAGATGCTGCAGGCCGCGAGCGAGTTATCGCATTTGAATCTCGCCAGCTGAAAGCTGA
TGAAAAGAACTATCCGGTTCATGACAAAGATCTACTTGCTATGACGTATGCGGTCGTCAAATTAAGAGTCCATCTGCTTGGCTCCAATCCATTCGTCATC
TATACAGATCATGCGTCATTACGCACGGCGACACAGTCGCCTCACCTCTCTTAGAGAAGGCTCGGTGGCTTTTCTTCGTTGCGGAATATAACTTCGAGGT
GAAGTATAAGACAGGCAAACGAAATGTGTTGAATAAGGCCCTCTCTCGCCGTCCTGGTTATGAGCTTGCTCATGTCACGACTTTGTCGTCTCCTATTGAG
GAGTTAATTCGTGTGGCATATCGATGGGATTCTCAATCTGTGGCATTGTTTCATGCCGTTAGTAGTGAGGAACATAAGTACTTGGACACTCAATTATAGG
CGCGCTTGCGTGCCAGCCTACATCGATATTACATCGATTGTGGCCTCTTGTGGTATCGCACGGATGCTCCTCGCATCGTCGTGTCTCACGATAAGGACTT
AAAGTACCGAATCCTCTTTAAGGCACAATTATACTGCCCTCGGTGGGCATTTGATCCAAGAATGCTCACCGAGGGCATGATAATGTGCATTAAAGAGTAT
TCGGTACTTATGACTCTGTGAGTCAACACTACTGGTGGCCCAAACTCTACAAATGGGTGAGCACATACGTGCGTACATTTGAAACAGGCCAGCGGGTAAA
AATATTGGCACATTCGGCTGCGCCGCTCGCTAGTTTGCTTGTTCCCACGGGGTGTTCGGAGTCCATCAGCATGTATTTTGTGTTTGTTCTTCCCAAAGAC
TGTGACGTCAATACGGGAATTGTGATCTTTGTTGACCGTTTAAGTAAGATGGATCACTTAGTGGCGGTGCTGGGCTCCATCGATGGTAAAGGTACAGGTA
TGCTGTTTATCAATCGTGTGTTTCGTCAACACGGGTTGACACTGGTAATCATCTCTGATCGCGACCCTCGCTTCACTGGCAACTTTTGGACCTCCATCTT
CAAGGTGCTTAGCACACGATTGGAAATGTCTACAGCGGACCATCCGCACACTCATGGCCAGACTGAGAGAGTTAAACGCGTCATTGGCGACGTTTTTCGC
AGTGTTTGTGCTGAGTCGCCTAAGACGTGGAGCTCAATGCTCCCCGTCATTGAGTTTGCGTTGAGAAACGGTGTTCATGCCTCTACCGGGTTTACTCCCT
TCTATGTGAATAGCCTCACGCACCCCCGTGTTCCACTCACGTTACCAGTACGTGGTTATGAGCTTGGAGGGGGAGAGCATGCTGACAAGATTGCTCAAAT
CAGCCCTACCACGATGCAGAAACAAAGGAGCGAATTTCTCGCGACGCGCTTTAGTGTCTTACGACATGTGCGTGATGCAATGGCTGATAGCCAAGACAAA
CAAAAAGAACAAGCTGATGCTATGCAGAGGATGTATTGATTCTGATGAAGTTAGAGACCAAGCCTTATTAAATGCTAAAAACCTACCTACAAATGTAGTG
TCTACCGTCTTCAAGACGAAATTGCGCCCGCGCTTCGTTGGGCCGTTTAAGGTCATAGCGAAGAGAGGCATTGCCTATACACTCAATCTCCCGCGCAAGT
TGCGCACACACCCAGTGTTTTACGTTGGCTTTTTTAAGCCATATTATGATCCTTCTCTCGTGGACCGGGAGGAGCTTGATCCTGAGGGTGGAACGTCGTC
CTCTCTAGCTG