Description :
From Genome Similarity Track
Location :
Scaffold_1115:3769- 6347
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1115-fgenesh-gene-0.0Armadillo/beta-catenin repeat family protein
Pytar_ATCC12531maker-par_contig_1115-fgenesh-gene-0.3Deoxyhypusine hydroxylase

Sequence
2578 bases(100 bases per row)
CATGATTAGACCTTCCCAAAACACCAGCTACCCACCAATCTGTCGCCGAGTCTCTCATCATGGATGCGGCCAAATTGTTGGAGGAGCATCGGCTCGCGCA
GGAGGCGCATGCGCGCGCGCTCGCCGACGTGGAGAAGATCCGCAGGCGACTAGAGATCGCGCGTGCCGAAGCAGACGAGGCGCGCGCTAGTCAGCACCAG
TACGAGCACGACATGGAGATCGCGGCCGCGAAGATCGCCGAGGCCTTGCACGCTATACAGCTGGAGAAGAACGACATTCCGACGGCACTGCCGCCAGTGG
AAGACTACTTGGTGGAGTACCAGGCAAATATTGGGTGCTACCACTGCTATCTATTCGTGAGCGATGGCGGCGCAGAGGACGTCGACACGAGCGTGCTGAG
TGTGAGCGTCGACGTCACCAAGGTGGTGATCTCGTCCGCGGCCGGTACATGGTGGACACTGGAGCTCGAGCGAAAGGTGGATCCAGAGAACTGCACCATC
ACAACCAAGGTACACAACAGGCCTGTCTGGAAATGGCTCGGTTCTTGGTGAAAACATAGTTGATAACGTGGTTTCCACTATGATAGGACGACCACATTTA
CGTGCGGTTGCCCGTGGGCGAGAGCGACAAGGAGACGATCGATGGCTTTTCGTCGTTCTCACAGACGTCGCCCAAGGAGCTACGAGTCGACAGCTATAAC
ACACTCGGCTGCCGCGGCTGCAAAGCGGTGGTCATGGAGAAGTCGCCAGTGGACAAAGTGCTGCCGCTGCCGTCGGAAAACTGGAGAGAGATGTTTGACT
TTTGGGGCGCCGGCATTGGCAGCTTCGAGCACATCCCACGCGAAGGCATCTTCGCTCACGAGTGCCGCGTTTTCGTGGGCGAGGCGACGATCATTGTCCA
TGAAAAGGACCTCCAGGATCAGGCAGTTCTTACGGCTGCCAAAGACATATCCATCCACGCCAAGGACGATGAGGAGCAGCCAGACTGGGTCCAGGTGAGC
TGCTCCGCATGCAGTGTCGTGCTCGGTGAACGACGCACTGAGAACCCCACCACGCTGCGCCTACAAAAGCATTTGATCACGGCCGCCAGTTTGGAGTCAC
CCGCGGTAAACGTGTTTGAGCGATACACTATCGACAGCACGATCAGTGCGCAGATGCTCCACATCGCCGAGTCCGATGGTGTCTTCCGCTTTCGACTCCA
GGCTCCAAGCGACGGACACGAGGAGCCCGCATTCTCCGGCCTTCAGTTGCAGCTGATGAGTTGGGACGCCAGGATCCGTGCCTCCAAGTTGTCTTCATGT
GCGACCGAGTTCCAACGCGTACTCAAGGTCGTCTACTCCAGTGCTGCACCTCCAGCCGCTGCAGCCGTCTCGCCTGTGTTACCAGTGCAAGCCGCGTTGC
CTCCGATGCTTCGCGTCCACGAGCTGAGCGTCACGCGTGCGGTCGGCGGCGAGATCCTGCGGCGACTCAAACAAAGCACTTTACTACTGCCGGCGTCCCA
GCGCAGCTTCAATAAGATGGCCGTCGGCTACCTGTTCGCATAGATTACGAGTCTGATGACATCCAACAGAATTGACAAGTGGATCTATTTCGCATTCCCG
GGGATCACGGTTTGTTTTACTTGGTCGGCGCCCAGTAGTCCATGATATCCAGCGCGACCTCGCAGCTCTCGCGCACGACCTGCTCGCTGTCCGTGAGGTA
CACTTGCAGAATCTCTTCGCACTCTTTCGTGCCAATGGCGCCGAGCGCTTCGGCGGCCTCGTGGCGCACCATGCGGTGCTCGCTGTGGTCCACCAGCACC
TTCTTGAGCGCGGGCACCGTCACGGGGTTCTCCATTTGGCCCATGACGTACGCGATCTCGTGGCGGAAGAGCGCGCTCTTGTCGTTGAAGCCCTCGGCCA
GCGCGAGCGCCGCGTCCGGCGTGTTGCGGTTGCGCAGCGAGAACATGGCGCGGTACCGATCAAACAGCGACTGCGTCGCGTCGAGCAGGACGCTCTTGAG
CTGTTCCGTGGACACGTGCTTCTCGGCGGCCGGCGCAGGATCCACCGACAAGTACGGGTTGCGGTCGTGTTCCGTCTCCTGGATGTCGCCGCTTGCCTGC
TGCGCCTTGTACTTGATGAGCCGCACGGCCAACTGGCACGTCTCCGAGACCTCGGGTGCCGGGTCCTTGCTGAACTTCTCGAGCACAGGCAGCGCCTTCT
CGTCGCCGATCGCACCGAGCGCCTCGGCGGCCTCGTGGCGCACCATGCAGTCGTCGCTCTCGTCCTCGACGATCTGCTGCAGCGTCTCGCAGGCATGAGT
GTTCTGGAACTGGCCGATCACGTACGCCAGCTCGTGGCGCATAAGTTCCGAGTCCTGCTTGTTCAACAAAGCTGTACCACAAAGCAATGGTATCAGTGGG
AGGATTCCAACTCAGTAGAGATGAACGGTGAACGCACCCTGCAGCAGCACTTCGAGGTCCTCCTTCTGGCCGCGCGAGCGCAGGTAGAACACGGCGCGCG
TGCGCTTGCCCATGGGCTGCGACAGATCCAGCAGCGCGTCGCGCAGCGCCTCGTACGTCGGCACAGTCTCCACCATGG