Description :
From Genome Similarity Track
Location :
Scaffold_68:37687- 39712
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_68-snap-gene-0.27Ubiquitin carboxyl-terminal hydrolase

Sequence
2025 bases(100 bases per row)
TGACGAGCTCCAAGTGGTGGCTGCTGCTGGTGAGTGTGTCTACAATGCGTGCTGGCGTGGGTTTGGTCTGTCCCGTCACGATGTGAACCAACTTGAATGC
CTTTTGCATTTTCAGCATTTACAAAAGTATCACCCCAACAAAAAAAAAGTAAAAAGAAAAAGAAACAATTCACAGTGTATGGTGGCGCAGTTGATGCTTT
GTGTGTATGAAGTAGCTAGCGATTCATTGGATTGTACACTGCTTTATCATGCGTCTTCACATTGCGTCCTTCCCGTCGGAACTTGGCTTCGCACGGCAGC
TTTTTTCAAGCTGCAGCACTTTGTCGAGGTCACGTGAGAGCTGATGCTGGGACTCCACGTAATCAGCGCAGCGTTTGTTTGCTGCATCTTTAGGTTGCGC
CGAGATTCAAGTGCACGACGGGGCTCTTGGTGCAGTAAGAGCCAAGATGTGGCTGCATGAACCTCAAATGTGCAGCGAACGGATCAAAGTATTCGAGCCC
AACAGATCGGGCCGACGACGGTGCAGTTTCCAAGCGTGAAAAGTTTGCACGGCAGGTCATTGCCGCCTGAGCACTTGTCCGTTCCTGGGCCATCAAGACA
CATCAGCAGCGGATGTCAAAGCTTGTCCACTACTCCGCGTTTCCACGCGTCAAAGTGAGTGAAAATGAACAGCTTTCGACACGGCCTCGAGGTCCATTGG
ATTCTGGAAATCCCAGGCTGCTCCAGCGACTGTAAGCAAAGACTTCAGAGCGCGGCAAGAGAACGAACGAGCTGGTAGCTGCTCCGATTGCTTTGGTACT
TTTACCAGCACGTGAATCTCGTAGGATGTTGGCTGATGTCATGCTGCATTTCCAGAACAGCCAGTATACTACTGCAAAGTCCTCCATGCACTCACTCCTC
ATTAGTGCATACGATTGATTGCCTTGATGTCATTGAGCCCATCATAAGCGAGTCTTCAAGTCCTTCATATCTTAACAACTGCCCGGAATAAGCCAGTCAT
CTAGTCGCTCCACGCACATGATGACAGTCGCTTCATCACCCAAAGAAGGAATCGATCGATTGTGCTGTGTACAGTGCGCTGTCATTCTTACCTTTCACTG
CTATCGTGGAAATCGACGGCCAGAGTTCATTCAAGCGCCAGTACCGGTACGTATTGCACACAATGGGGTTTGCTACTTTCTTCATAATATTTTAAAGTGA
TAAGGCTTCAAAAGATGCCCTATCGAAGGGTTTACTAAAAGATCGTTGTCAAGGTTATTCACTTTGTGGGTACGATTTACCAATCGATTCAGTGGATGGA
CGCCTTGGCGCCCCATGCGAGTGCGCTACTCCTTCACTGCATCGTTGCGTGCTAGCAACCCCTTGTCACAAGGCTTGTGTGCGTTCATATCTCCCGAGTA
GACAAACATACTCTACACCCAATGATACTCAGTAATAAGCGCCATCGTCGCTTCAACACGCGCCGAGTTTTCCACCGTATCTTTAGCGTGGTCCACCTTA
TTTTCCCTCTGTTTTCGAGTGGGTGGAAAGTGAGTCCCATATTCATTCGCACTATAGAAGAAAAAAGCCCCGATCGCTCGCTGTCGTTCGGTCGGACGGC
GTCGGCACGAGAGAAAACTCTGGAAGGCGATTGCTTCACGGGCTTCTGCTGCTTGTATACGTACGCACTTTCCCCCGCGCAGTAGAGTGGAATCGTGATG
GCGGAGGTGACAGAGGATCCGCCTAAGGCACGCAGCGACAGCTTCGCCGAGATCTGCGAGCAGCTCGAGCACGAGATGCAGCCCACGAGCGAGCACGCCC
CCAGCAGCAGTAGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACATTGACGACAACACG
TACGCGTACGGCGGTGCGGATGGCTACAACAACGACGGCTACGAGGCGTATGTCGCGCCGTACAGCTCGTCGCCCGTTGTGTCGAATGCCGGNNNNNNNN
NNGCAGGGACTTCGTCCATGTCGAC