Description :
From Genome Similarity Track
Location :
Scaffold_1611:3768- 4926
Transcript NameFunction/comments
Phypl_g13822hypothetical protein

Sequence
1158 bases(100 bases per row)
GCGCCCTTGTCCGGGAACGCCAACTTGCACGAGCGCTCCACCATTTCGAGTGTCTTCCTAAAAGCCCCCGCTTCATCGTCACTCCACTCTAGTATGGCAC
CACTGAGCTGCGCTTTGCGGCGCCCTCGATACTGCATCACATGTTCCAGATTCTCCTGTAACGGCGCTGTAGTACGCGCATAATCCACCATCGAGTCTCT
CAACCAGTTGAGAGCGCACAGAAAATGCTGAAGCGCAGCTCCGgtcggcggcaacggcatctGCTGCAACGCAGCTAACCGCTCAGGGTCGTGCTCGACG
CCCTCACCATCAATCATCTTGCCGCACCACTTGACGCGCTTAGCGAACAGCTTGCACTTGCGAGCattcagcttcaacttgcgcTGCCGTAGGATAGCGA
AAAACTTGCCCAGATTCTCTAGAAATGCTCCTGCCGTACGTGCGtagagcagcacgtcgtcgatccACATCAGCACGCTGCGAAACAACAAATCCTTTTG
CACGTCGTTCATCTGTGCTTGGAAGTGTACTGCTGAATCACTCGCACCTTGTGGTACCCGCGTCGGAGTGAAGATGCCGTCCTCCGTGACGAAACTAAAA
ATCTCCCTGCTGTCCGGGTGCAGGGGCATCTGCCAGAAACTCTTGTGAAAGTCAAAGGCCCCAAAGCCGTACGACCCGCGCACGGATTCCGTCACCACAT
CAAGGTTCGGAGCAGCTCCGGCCAGTGGCACGGTGAGTCGATTCACGGGCCTGTAGTCAATAGTAATCCGGAACTCATCCGTCCCTTGCTTAGCCACCGG
CAGCGCCGGACACGCCCAGCGGCTCTGTGTGTTGCGTTCCACGAGACCGGCATTTTCGAGTTCCCGCACATATTCCCGAAAGAATTGGCGCTGAGCCTCG
GGATAGCGACGGACGCCACTACGGTAAGGCGGCGCGCCGTCTTTTAGACGCACTTCAAGTGGCTGGACGTCTGCTGCCTCGTCGTGCCCAAGGCGCACTC
GGAAGACATCAGAGTAGTCGAGCACCGCTCAACGGCCATAGTCGGTTCAAAGCCTGCTTCGATGGCTTCATCGACTAGATTGTGTAGCAATACGTCCacc
tcgccgccgtcgctagCCCCACACAGCTCAACATGGTCGCTCGGGATGCCATCTGCCT