Description :
From Genome Similarity Track
Location :
Scaffold_1:3767383- 3769279
Sequence
1896 bases(100 bases per row)
CTACTACTGCTCGCAGTTCACGCAGGCGGCACGGTCGCGTTACTACTCCGCCAAGCGGAAACGAAATGAACATCTGTGCGACTACATAAACAGGCTGAAC
GGCTACGCTCGGACCGCCCGTCTACACTTTGAGAAGAGTGGTCGCGACGCGAAAGAACACGTACAGCAATTCCTGGCAACATGCGACGATGACAAGCTAG
CGGAGAGTCTCTACCACGCTCGAGTCGCCGACATTCACGAGCTCGAAGAGATCATCGAAGATGTTCTCAAGGGCAAGGAGAGAATGGCCAAGCGTGACAG
TGAGTACCGATACTCTAAAGAGTCGTGATACGCGACGCGACGATGTGTACGCCCGCAACAACCGGCGTGATGACCGTCGCCGCGATGACAACCGCAACAT
ACCAAGAGTGACACTCATTGAAGCTACGGTGGACGACCTACTAGCTGAATTAGAAGGTCGGGGAGCTGCTCAAGGAGGCAACGAGTATTCAAACGAAGAT
CCGAACGCTTACGACAATGTCCAAGATGAGTACAACGACTTTCAGCCCGATAATACGGATGGTGATTTCTCATTGGATGAAAACGACCGATACCTCGCCG
CTGCTAACGAAAACGAGCGCCGTGCAGCTGCTGAAGGCACCTACGCACGTTCAGACAACCGTCAACTGCGTGGAAACACGCATGATCGCGAGAATGGCTT
CAATCAAGATCGCCGAAGTAGTGACCGTGGGTTCAATCAGGACCAACGCGGTCGACGTGACTTCAACCGCGACAACCGACGCCCACAGTACGGACCATGC
GCGGTGTGCGGTGGCATTAGTCACTCCGCCCACTACTGCAACAAGCGATGCAAGTTCTGCAAGCAGCTCCACGATGCTGGACAATGCGAACTTTTCCGCG
ACTTCCAAGACCTTGCCAAATTCGTGCGCACTAAAGGCACGAAGGAGGAACTCCCGCCAGAGCTCAAGGCCGTCGTTCAAGAACGTCATTTAAACTAGGC
AGCCCGCCAACTACAACTGGGTTGGTCCCTATCGGGCTGCCACAGCTAACCGAGCCTTCAATGGAAGCAGAGTGTATCTTTGCTTTCATGGGGCAGAGGG
AATGGCCTGATAATTACGTAACAAGTGTGAACGCGACGGAAAATGAAAAGGAGAGAAGTAGAATCCTCGGTGGAGGTGTTGGAGAGAGAGTGGAGTGTGC
TGATGCTGATGAGGGCACCAGCGAGGATTCGCTCGGCTTGGATTCGAGTGCAGCGCGAGACGAGCCCCAGGGTCACTCCAAGATGATGAAGTTGAACCCT
GGCGAGAGACAGGGGTCAGGAAATTCGACCGACGGATCAGAATGAGAGCTCTGGTGCAAGGGGCAGTGAACGACCAGCGAACGAGGATCCTCCTCGACAC
GGGAGCGAACGTTTGTGTGATCACTGACGCCTTTGCCAAGAAGTTGCGACTCCGAGATGTACCCGATCACGGACGCCGCATTGACATTCAAGGAATCAAC
GAAGGCAGGGTGTCTACGACACGACGAGCGTGCGTCAAGATTACACTTGGATGGGAGATGGTGTACGAGTTCGAGATGTGGGTAATGGCGCATAGTGCAG
GCGTCGACGTGGTACTCGGGACCGACTTTATGATCCCAGCTGGGATCCGGTTGGACCTGTTTCACGGCGCGGCGCAATTACCGCACGAAGTTCAAATCCC
ACTGATCAAGACCAAGAACATGATCGACAACGAAGAATTCGGCTCCCATGCTAACGCCGGGCCGCCCGAGCGTTTAGACATTCAAGCGCACGAGTGGCGA
GAATATCGACTAGCGAAGCGTCAAGTCGGGCTGGAAGAACACGTACTGTGGGGTCGTCGAACGAGCAAGTTAATCCCGTCAGTGACGAGGTTCGAC