Description :
From Genome Similarity Track
Location :
Scaffold_558:3767- 9205
Transcript NameFunction/comments
Phyta_totarag9249conserved hypothetical protein

Sequence
5438 bases(100 bases per row)
GTTCAACAACTCAACCATACAGATTCTTAGCGATTTGCATAACCATCAGAAAACCATATTTTTGATCAAATTTGGCGCAGCCCAAGTAGAGGGTCAACTT
AATGGTCACCCCTTTTTTGGGGGGTCAAGAGAGGATCAACTTTATCACAACGTGGAGGTGATAAGGATATCTCACAGAAATATTCATTTTAGCGGATCAT
AGGGTGATATAACCACGTAGTTTACTCAATTGCATCGCCCTAAGGATAAATATAGATTAACCTCACTTCACGTTTGAAGGGTTGTGCTTGTTGCCGATCT
AGAAACGCACACAACAAAGCGACGCCTAACAATCAACGACCGAAGAACGAGCGTAAGACGAGCGAGGTAACGCCGGTTATTCGATGAAACGAACACGTGC
GTACACCAAGAGGGGGAAGTAGGGGAAACTACACAAACAAAATCGAAAAGCTAAACTCATAACGGaactcactttccaattttcGCCCTCTTCTTCAAGG
CAAGCTTCTCTCCAACTTCACCTCACGTCACCGTGGCTGAAGATCTTTCTTCCAACACCTTCGTGCCGAACCACAACCCTTACGACGAATCTGACATGAG
CGACATTTCCTCGGACGACACTGAGATTTTGCTTGGGCAATCGTCGGGCGATAACTCGGCGCTGAGTGAAGgccaccaagttgaagttgaaaacGACCAA
CACTCGGAGCAACCTGTCATCAAGGTGGGAAGAAGTGTGTCAATTACCAAGACTACCTACTACGGAACTGGCGACACCAAGCGCTATCGGTGCAGCCCAT
ACAGACGGACTGACTGTACGGCTAAACTTGTCGTGTCCAGTTTGGGTACTGTGGTGCAGGGGGCCCAAAAAACATATTGCGTCCCAGAATTGCATCAGCC
CCCAAGATGTCCGACCTCAGTTTTTGTcgactgcaagcagcaaatgctccTTGCTACCGACGAAATAGGCATTCGTGATGTAACGCTCACTCCAACCGAA
GTTTGGCGCCAGATTCGGGACCAATAGTACAATGACAACAGTGTGATTGTGCAGGGagcgaccaagaagcagattgTAGGTCGACTCTATTGGACGCGGA
CGAAGTTTTTTGGTCGAGACATTTTTGGGCGACTTGAGAATGAGCCTCTTTGCGACGTCAAACACAGCCCGGGACTCAAATTCTTTCAATTCCACTTCAC
CTACTATGAGGGCGAGGTCCTTCATCGCGTGATCGGCGGGGCACACCCACACGTCCATGACGTTCGACACATGCTCATGCATGACTGCCAGTACCAAGGA
ATCACATACTCGCGGGAGAACTGGAAGAAATTCTGGAACTATTTTATGAAAACCTAGATCAAGAAAGCTGTACTGGAACGGTGGAACATCAACAGTTTAT
ATGAAGACATCGTAAATCGAACAAACAATCCGCTCGAAAGATACAACCGCACACTCAACGACACTTTCTCCGTTGCACATCCTGAAATAACCCAGTTCAT
CTGTGTCATCGAGCAACAAAGTCGAGAGAATGTTCAGCTTCTAAATGACATATCGAATCGCAGAGCTCGTGGTCCCGCCCACGTCGATTCTCAACACGCA
CCGGGATTTCTCTCAAACTCAGAATTGAATCTGGGTGGATCCAGCTCGGAAGACTCCGATTCAGATGATGGTTCAGTACGATCAATGTCACCGGAGTACT
GAGTCAAATAAGGCGGCTCAAGTTACTTGCATGTGACTAAAATAATACGTCCTACCCATTTACTTTAATTTGAGCACAATTATCTTTTGGATTCTAATTA
TTTTATTGTTTCATAAAAATGACTTGAACTCACTATACTAACCGTAGTGGCTAAATAAAAAAGGTAGTTGTTTTAGCCAATCGAGAATGTTTGTGCCCAG
GGAATAATCCCATCGACCGTCCGCCAAACGACTTAGCGACTGAAATTTCACGGTGGGAAATGTCCGCTAAATTTCAGTCAGTCTGATCCATACGAGATAC
TCACCCAGAAGAGTGTGTCGAGCGGCCCAAGCTCTTGGTTATGTCTCAGATCTGACGGTGAATTTGCACACGACATTTACctcaagctgtcgagctcTTC
TACAGGTGTGGGATTTGAACCCACGCCATCTGATAGACAACGGTCTATCTAGGCGCACCGCCTATGGGCATACTAAATTTTTAATGTAAATCACGAGCTA
TTTGTGTTGGTACCTCTATATGTTGGTATATACTGGAGCTGATAACGTATAAAGTTTGACGGTAGTATAAGCTAGTGTATTCAATGAGCTTGTTTAATGG
TCAATTGATGGTCAACTTGACCCAAGGTTTACCCAAAAAACTAGTTGAACCTCTACTTGGCCTGCGCCAAATTTGACCCAAAACAAATCGCTCCAAACAA
TCATATTGGCGAAGACAGACAGGTTGAATGAACACCTTTGTCGAAAATAATCAAGATTATGCACAAGAACAGCGGATCTTTGTGttctttaaaaaaaaaa
agaacACAAATCTCCGCTGTTCCTGTACATAAAAGAATCATCTTGGATCGTCTACGGGTATCCGGATACAATGtactctacatgtaccgtagCCTTATAA
TGCCTTTTTGAGCATGTTGTTTCTGTGGTGTTAGTGGGGTCGGTCATGTGGGTCTGAACTAAGCTGGATAAATTCCGCTTCGATTTTCAAAGCGCAATTG
GGGTGCACTTAGTGGAAGACAATCCTCAACGCGCAATTTCGTTCGGTATAGCACTTTACAGACAAACTCGATTTAGCCTCATACTTATTTTTCCCCTTGC
AGATATTTTGCCCGCTATTTTAGACCTCTAAAATAGTCTATACTGTCTCTTAATCAGTGTTCATGAGAAATGTAAAGTAGCGCTTCATTTTTTTAAAGTA
AGGGGTAGGGTTCTAACAACTACCTATGTTTTGTATAATTAACCTAACCTGATACAAGTGCTGTTCGGTTGACCCTTCTTAGCgaattgaagctgcttcc
TAACTTACTTGGATTTGTATATGTCTACGCCGGAAGCGATTTCCGCCGgccaaaacaacaaaatatGCAAAACCAGGTTGCATGACCAATCAATTCCCAG
CATTGTGCTAATAAACACAGGCCCAAAATATCACGTTTGCAAGTTAGTACTGTGCCGATCTTGACAAATTTGAAGGAACTCAGATATTATTTAGGAGACA
CCAAGACACACGTATGAAATAGACCAAGACCAAAAGTACTGACAAGACTGAGGGTACTAAAACAAGACCGGAAATGCTACGACAAGACTTATTGTACTAA
CACTACTCCTTAATTAAGATAGGTATGTTGAGACTTCACGAGTCGGCATTTTTTGTCGAGACGAATTTATCGTGCCAGGGTATCAATGGTGAGTACGTTC
ACACTTGGACTTACCGCATCTTTCAACCAAGGCTTGATGTAGTAAGTTGCATACACAGATAGTGTAGACTCGAAGGCCTCCTGCGGGCTAGCAAGTCCTT
TATGAACAGCAAAGTCGACTACGTCTTCAGTAATAATCTTGGCAGCATTGAGTCGACTAGGAAAAGCTCCATTTTCGTTTTGTCCTGGGTTGTCACTCGC
CTACGGGCTTGAATAGATGGCGTGATGGGTCAGCTTGCCAATACATTCGGGGTAGATCCTTCCAACTTTCGCGGGTGGGAGAATAGATATCTGCTCTATG
CAGGGTGACCATTCTGTCGCAGATACAGGTGTGTCTTGTCTTAAAGGCTGCAACATGGATCCAAGTATGTCAATCTTGTCTTCACGAGCTTTTATTGAGC
TCTCAACGGTCTTCAGTCATTTCTCAAATTGGCTGTCAGCGAATGGCAGTCCGACAGCGGAAACTGTTGCGTTTCCTTCTGGTGAAGGTGGTATGAGAAG
TAAACCAGATGTCACGCTACTCTTGTCGAACATAGCCACGAACACATGAGCCTTTTTTATAGAGATCTCGCACCGCACAGTTGAGTGAAGTAACAATTAC
CTGCTTACCTGCTCTGACATTTTCTTACTCCACCCCACGCGTGCGTTCTCACAGCCTGTAGTCGTTGCGTTTGTCTTTCGAACATTTTTCGAGATTTTGG
ACGGCACCGGGAAAATGAAATCGCTGCCAGTCCAAATATGGTCCGTCTTCATTTGAACGTACGTCAGCCGCGGTTTTAAGCGAAACAAAACATCCACGCA
TCCATTGGTCTCTCACTTTCGTCGAGATGATACAAATTGTAGCATCACCCTTCGGCGACCTCTGTCTTTTTCCTTCAAGCTTGTAGGAAGCAAATAAATG
GATACGCTCGGATCGGAGGTACTGTTTCGGGTCAATCCTAATGTGAGATGCTTCCATTGTAGACTGAGCACCTCGTTGATCCGACACATGCCGTAGAAAA
CGAGCAGTGAACCAGCAGAAAACACAATCGACTTGTTTCCGTGAATCCTGTCGTGTCGTCCAAGTTGCTATGAAGTACCCAGATCATATCGAGAGAAATC
GGAGTAGCTTGACGCTGCGTAAATTCCGTGCTCTTTCGCTTCTTGAGACCCCGTATGAACTGGTGAACAAACGCGTCCTTCGCAGGATTTGCCAACCCGT
ACTTGATTCCTTTGTCGTCCGTGGCTACCATCAATGTGTCCGGCCCAGCTGCATCACGGCGTTTGTAGCTGCCATAGTAATTGGCAACAGCAGCCCGTAT
CGTCTCCGCTGTTTGACTAGACACAGCAGCGGATGTAGACACGCTCTCCGTGAACACAACCAGAAGAGAAGGCAGCTGTCCGGGTACTCGTTTGAGGTAC
AGAATTCGCAGTGAAATAGGATGTGTTGACGTCCCTAGTTTCCTTTTTGATCACATGCATGGCCGCAACGGTACCACCTTGTAGAAGGTCTTGGAAGGTA
GGTGGTTGCGTAGTCATCGCAAGAGATGGAAGGGTTTGCCGCTCTGTTCCCTGTTCAGTCGAATGAATTGTGAGCTGCAAAAATACTAATTTTACCCTAG
TATTTTAGTCTTGTTGAGTATTTTCGGTCTCCTCGTAGTCCTTTTAGTATTGCCATAGTACTTTTGGTCTTGTCAGCACATGTATTACATTCATATTTAG
GTCTACATAATCATGTTAAACCGCACTGTGTCTTAGTTGAGTCTACGTAATCATTTTGAGACCCGACATGCCTTTACGCACCCTCACTATCGGAATCAAG
GCCATATACCTCCCGAAAGCGGTGCTCTGCTACGATTTCCTCCGCCTTCGCATTCATCTTGGTCTCATACACGTTGTCCTTTCCAACAAAACGTTCCTTG
TAGATCGCCTCAATCTCAGCCAGAGTCACGCAAACCTTGCGTTCTCCAAACTTGTCAATCTGTTCTTGGACcggagcttccagctccatATTCTTAATAC
GTACCTCTCGCATTTCTGCAGCCAAGCCTCGACCTTAT