Description :
From Genome Similarity Track
Location :
Scaffold_1520:3767- 5672
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1520-snap-gene-0.2Zinc finger family protein
Pytiw_DAOMBR242034maker-piw_contig_1520-snap-gene-0.3Gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_1520-fgenesh-gene-0.1Extracellular dioxygenase

Sequence
1905 bases(100 bases per row)
AGCGCGTCTGCATCCAGTGCGCCCCGCAGCTGCACCAGTACCAGGACGCGTTGGTCGCCGAGTTTTCGCAGTCCAAGGAGGAGAACCTGCACGAGTCCAA
GGGCACGCTCATTCATGTCCCGTTCAGCAGCTCGCTCATGAAGGAGTGCAACAACGCAGCAGACATCATCGGCAACTTCTTCCGCGACAGCTGGGGCGCG
TCGGCAGATCGCTCGATTCCAGTCGCTTTCCTGCAAAAGGCCCACGGCCTGGCGATCATGACGATCATCAAGGCTGGGTTCATCGTCTCGGGCAAGATCG
GCACGGGTCTCGTAGTCGCAAAGTTGCCCAACGGCTCGTGGTCGGCGCCGTCTGCGATCGGCACGCTCGGTCTCAGTGGAGGGTTTGAGATTGGTGGCGA
AATTGTCGAAGTGATGATTATTTTGGGCTCGGAAGGCGCGGTGAAGGTGTTCCACAAGCCGCAGGTGAACCTCGGCGCTGGCCTGGACGTGACTGTGGGA
CCCTACGGTCGATCTGCGCTGGCTGCTGCCGCTGTAAGCGCCAGTGGCTTGAACGCCAACTACAGCTACTCGCAGAGCAAGGGGCTGTATGCGGGCATCT
CGCTCCAGGGCGCAGTGATCGCTGCGCGCTCCGATTTGAACCGCAAGTTCTACGGCCGCGACCTGTCGCCAGCCGAAATCCTCGGTGGCTACGTGGAACA
GCCGAACGCCGCACGACCGCTCTACGAAGCCATCGACATGGCGATGCAGGGCGTCGAGGACCACAAGAACGAAGTGTCGCGGCGCTCGTCGATCATGGGG
CCCTGCCGCCTTTGCAACTGTCCGATGTTCAGTGCCCACACGAAGCAGATCTGGAACAAAAACTGCAAGACCTGCAAGCACGTGCACTAAGGATTTATCA
GCACACTCGGGTCCAGTGAGACAGAAGACGAGACGAGGAATCTTGTGTGGAGGAGACAAGCAGCAAAAACTTGTGAGTGACTTTTGAATGAGCCATTTTG
TATTCTCGACTGGTTTGCAGTCTCCACACTCGATCCTCTCATCTGGTGTGTGCGGATGAGGCCCAAAGAGCTGCAGCAGTCGAGGGCTTTTGTATTTTTG
ACATATGTGAAGAGAGTGATTATACAGTCACTATTGAAAGAGACTGTCGATTCGAGGTGGACACACGAAGGGTCACGAACAGAAGAATGGTCTTGCTTTT
CATTTTTCAGGTGATATGTAACAATGCAGGATATGTGGCTTTGGCTTCAAGTGTGGCTCAATGGGAGGCAGCTTTGAGTGATATACTTACGAGCTCTGGA
CGCAGTCGCTGACGCNNNNNNNNNNAGCATCGCTTGTATCTCTCGTTGGTGGCTCTTGAGGCGAATCGCCAACTGAAGTGAGCTCTTCATGTGTGTGATA
AAAAAAAGTTTTTTTTTTATCATGATGGAACCTACCTTGGTGTATATTCTAGAAGATGCTATTGGATGGGATCTCGAATGTGCTGGAACATGCATGTCTT
CGTTGAGAGGTGGATACTAGTGTCTCTCTCGCTCGGTACCTGAATCAAAAGCGTCCACTGAGGACAGACAGTGGCGGCACACAGTGACAGATAGTCGAAA
GCTGAAGCGTTGTCTAAGAGTAATGTATTTTGTTTTATACCGAGTCATCACAGGATCTGACATCGGGTTATGTATGACATGCAAACACGAGTGCGTTGAA
AGAACCAGTAGCTTACGAGCTCTGGACGCAGTCGCTGACGCTCGAGGCCGTTGGCGTCGGTGTGGCACTCGTGACGGTCGGAGTAGCGGTGGTGGGAGTC
GGAGTGGGGGTCGTGACAGTGGCACTCGAACCAGCCGTCGAGGACGGCGAGGACGCTAGGGCCTCAGCGTCGCCGCCCACAGACCCAGCCGACGGAGGCA
TGCCG