Description :
From Genome Similarity Track
Location :
Scaffold_1963:3767- 5330
Sequence
1563 bases(100 bases per row)
GCGAATGATAACTACGAAGGCTACATCGTTGTCGTGGGAGACGGAAAAGGCTGCCTGAGCATCGCCCAGCTGCGCACAATGGAAGCTTTTCACGAGGGAA
TGGACTGCATCCACACAGTCATCACAGCGGGCCATTGGCTAAAGGATCTCGACGTCAAGAAAGGTGTCCAGATCCCCAACCCATTCAACGAGATCAGCGA
CAATTTCGACGAGGTGAGTAGCACATATACCAGCTGACATGTGTGGGTTGCTCATGTTGGGTGCTATCTGGACAGGCGTTTATCACGCATGCGGTGAAGC
AGATCGGAGACATGTCTCTTGGCGTTGTGCGTTCTACGTACAACGTTACAAATGGGCACACTCTCCAAGAGATTGCGAGCAACAAATGGCTCAGCACAAC
TTCCATCAACTATCATGTACAGCATCACCAGCCTGTACCACGGCGTCGGCATGATAAGGGCGGAATACTTCACGATCAAGAACGAGGAGATGCGACTGCG
GACCATCCAAGCATCGTCCCCTTCTGATGAGGAATACTCCCGCGTCGTCTCGATCGTCAACCTAACGAGGGCTCACTGGCAGGCTTTCTACGTGGACCTG
GCAGCGAATGTTTGCATTCTGTATGACCCGCCCTCTGACGACATGGCCAGCGTTTGCAACCTCAAGAATTGTGGAGCGTTCGGCGGAATCGTGACAAGTG
CAATCAGTCGCTCAGTCTCTCGGATGGTTGGTGGTTTTGGTGTGAACTTCTTGAGGTAGTCCCGAGTGATCGGCTAAGTGAGAGTTACTTTGGCGACGCT
AGTGGACCGAGATGGAGCAACGTACAGCGTTTGATGAGGGAGTCCTTTTTGCCGCTCCAGCTTCGTTATGATGATCCCGTCGTGACAAGTACACAGTTCG
CCTGGGCATCTTCTCACTCCGCGACATCGAGGCCTTGACCGAGTTGACATTCGCGTATCGTCAGAGCGGTTTGTCGTTATTCTCGTGTGCATGTGGAGCA
CCAAATTGCGTGTCGACAACTATGACAGAAAATGCAGCCTAGTTCCCTTTCACTATTAGTCGCTTACTGGCTTGTGCTTTGGGTTGATCTGTGGGAATGT
GCGCTCCTATGTGTGGCACCATGTGTGAGTACGTGGCGTCGAGGCAACGGCTTCATGTGCGGACGAAAACTCGATTGTAGACTAGAATGCTCCGCACGAC
ACTAGCATTGAGAAATATTTGCTCATAATTCGTTTTGATTTTTCTCGCTCGCTTTCTTTCGCATGCGGACTGACATGCTAGTGAAGCGATGCGAGAAAGA
GAGCAGAATCTCTTCGGCTCGCGCCGCTCGGGCTCACACCGCTCTGCTAAATGAATGGAGTGCTGGCGTACTCAATGGAGTACACCATGGCTGCTATCTA
CACGTCAGGACGTGGGGCAAGTAAAAGTGTCGTCATCAGTCACTATCAAGCTGGCTTTCACTACATGTATATGTCGTTAAAGTGGGGTCTAACTCGGTTT
TCCCCTGGCTCGCACTTTATTGAACCGGCTGAGTGCGGTAAGGCTGCAAGCAGCCGGAATTTA