Description :
From Genome Similarity Track
Location :
Scaffold_23:37667- 39971
Sequence
2304 bases(100 bases per row)
TGATCGAATTCAAGGACGTATTCCCTGAATCCGTACCATACGAATTGCCTAAGGATAAAGGCGCTCGATATAAAATCAAGCTTAAATCGGGCTTATGAAG
CAGTGGCCACTGCCTCGTGAACAAGTACTTGCGATCGACAGGTTATTTGCCGATCGATTAGCTGCGGGTCATGTGAGGGAGTCAACTTCCCTATACAGCT
CTCCGACCTTCTGTGTGCGCAAGGCCACAGGAGGGTGGCGGATAGTGCACTCATTTCAACAAGTTGAATGCTGCAACAGTACCGGCTCAAACGCTGATAT
CGAGGAAGGACGTAATCATAGATGGAATGTCAAAAAGTACCATATTTTCGTCCATGGATCTGATAGATGCCTTCTATCAGATCTTTATGCGTGAACGGGA
CATCCCGTTCACGGCAGTAAGCATCTCGAGCGGTATGCTCCGGGAGTGGCTAGTGATACCACAATGGCTTAGCACTGCCCCTGCCACCTTTAACAGGTGT
GTTACAGATCTGTTGAAGCGAGACATCGTACCGAGTTACTTCGACGATGTATTCGTCCATAGCCGGGCTATGGGCGGAAAGAAGGACGTAGAGGTTCATA
GAACATACGTTCATCAGGTTCTTACGCTTATGCGCAAGCATAAGATGTATGCCAACCTCAAGAAGTGTGTACTCGCTGCTAGCAAAATGCCACTTCTTGG
GTGCATCGTGGCTAAACACGGCGTACGCCCTGATCCAGAAAAGATCAAGGCGATTACCGACTGGCCTGTGCTAGTCGACGTTAAGAGACCTAAACGTTCC
TTGGTCTAGAGGCGTACTTACACAAGTACTCGCGCAACTACGCCGAAATGACCTTAACCTCTCTCGTCTTTTGAAAAAGAACTAGAAGTGGTCATGGGAC
GCTGATTGTCAGTGTTGCTTTGAAGGTATTAAGCAGAGCTTGATGCAATCGCCCATCTTGGCGATTGCAGACCAAGACAGACCATTCCATGTGGTCTGTG
ACGCCAGCTATTTAGCAATCGGCTGCGCGTTAATGCAGTACGATGCAGACGGCGCAGAGCGCGTCGTCTGTTACCAATCTCGTCAGCTGCAAGAAGCTGA
GGGTAATTATACAGTGCATGACAAGGAACCCCTTGCCATGAAGTATGCACTGGCAAAGTTTCTCGTCATCTCCTTGGAGATAGGCCGTTTGTAGTCTATA
CGGACCATACGTCATTACGCACGGCCGTAAACAGCCCACACCTCTCGCAAAGGATGGCGAGGTGGCTGTCCTACTTTGCGGAGTACAACTTCTCCGTGAA
GTACAAACCCGGACAACTTAATGTCGTCGCGGACGCGTTGTCACGCCGACCCGGTTTCGAGTCGTCTGCGCAGTCCAACAGTGAGGTTGATACCACTGTT
AGAACACTAGTCACTAGTGCTCCGTCGTCAACATTGTTTGACGCCATAAAAAGGCCTACGCAGAAGATAAAGCTCTTATGCGACGAATGGATCATCTGGT
GTCTCCATATCGTAAAACTCTCAAAGATTTACCGGCCTTGTATCGATCTTCCACAGATCGATACACAACACGCAACGGGTTTCTGTATTCTACAGCCGTT
GCCGGCGACACACCTCGTGTCGTCGTCCCTACTCATAATATTTGCTCTTACGCATCTTGTATGAGTGCCATGATGCATCACCTAGTGGGCATTGTGGGCG
TGAGAAGACTTATCTCACGGTATGTCGTGACTTTTATTGGCCCCACCAGTATCAGTTCGTGCGCACGTACGTTCGTGCTTGTGAAGGTTGCCAAAGGGTG
AAGCCCAGTCGTTCATCTCGTGCGCCACCACAGCCTCTACAAATCCCGGCAGAGTGCTGGCAGTCCTTTTCAATGGACTTCGTCTTTGGTTTCCCCGAAG
ATGCTCACAATAATAATGGTATTCTTGTGTTCGTAGACCGATTCAGCAAGATGGTACATCTTGCAGCAGTTAATGAGTCAATCGCAGCACATAGATTGTG
CCCGTGTCTTCATTGACACGGTATTTCGACTCCACGGTCTACCCCGTGAACTAGTCTCAATAGGTATCCTCGGTTCACGGCAGCGTTTTGGCAATCCGTG
TTCCGGTCCCTCGAAATAAGTCTGACTATGTCTACTTCTGATCATCCCGAGACTGATGGTCAGACAGAACGCGTCAACCGCGTCTTCGAAGCGATCCTTC
GAGGATGCGTCCAATCTTTCACATATTGGAGCGACCGATGGTGGAGTTTGCAATCAACAACTCCGCGCATGCATCGACAATGCATACACCATTTTTCGCG
AACG