Description :
From Genome Similarity Track
Location :
Scaffold_25:37665- 48636
Transcript NameFunction/comments
Phyra_77486chromosome 20 open reading frame 23, isoform CRA_b
Phyra_77487G patch domain-containing protein 1
Phyra_77488nucleolin, putative
Phyra_77489Hypothetical protein
Phyra_77490predicted protein
Phyra_77491conserved unknown protein

Sequence
10971 bases(100 bases per row)
CGACCACACGTGCAAATGGACTCGACGCTCGACCAGCTGCAGCGCACAAGCTCTTTTGCCTCCAGGTGGCTCTGTCGGTCTTCTGTTGCGACTGGCAATC
GGGTGTTCAGCACTTCGCAACCGCCGTCCCACACGCGCCTTTCGGCCATCAGTTCGCCTTCTCATCTGGTTCGCCTGTAGCCATGAGAAAGTCTATGTCG
CTGCCGATCGCGCCGCCTGTCAAGCTGCGCCGCCGCAAGTCGTTGCGGGAGGAGCAAATGAGTCGTTCATTCTCGTTCACCAAGCGCCGCGTCGAGCGGC
AGCCGTCGCGCCTCACACCGATGAAGTCCATGGAGCAGACGCTGCTGGACAACGTGCACGTGGAGTTCGTCAAGGCCGTGGTGCCCGGCCAGAACAAGCT
GGCCAGCCCGCGCTACGTCATGCGCATCAACAACACCGCGCTGGACCAGACGTGGGAGATGGCGAGGACATTCAAGGAGTTCTACGAGCTCAAGGAGGCG
ATCGTCCGCGTACTCGACTACGGCCACTTCTGTCCTTCAAACTGCCCGTGGCTCTACATGTACGCGGCGCACCACTTCCCGAGGCGCCACATCTTCCGTT
CGCGTAGCCCTTCCGTGATCGCCGGGCGACTCACCGAGCTGCAAACGTATTTTTCGACGCTGCTGCGCATGGCCAAGCAGAACCGCAACCTCGAGTGCGC
AGTGTCATCTACCAAGCTGCCGCAGCTCATCTACGATTTCCTGTTCGAGGGCATGGTTTTCGACCGCTCCGACTTCATGCGGTTGAGCGAGCGTCTCTCG
ATAAATACCCGCGACAGCAGCTTCCTCGACAACGACCCGACACAAGATCCGGAGGAATGCTTCATCTGTCGCAAGGCTCTGGTGGGCGACTCCAGCGTAT
CGATCGTCCCAGCAGCTCCAAGCAGTAACAGGGGGCCTTCGAGCAAGAAACGCGATAAGCACGTGATGGCGGGCCTCACGACTCTCGACTGCGGCCATTG
CTTCCACGACGAGTGCATTCTCGCGAAACTAAACGAGTCGCTGACTTGTCCACTGTGTATAGCGCAAACCAGTCCTCCACAGTCCGGCGTCGCTGCTGCC
TAGTTAACGAACAACCCGTGCACTAGAGACCTCTTAACCTAGCTAGAAGGCTGTGTGTACTTGTTCATAAATGACATGGGAGCCATATTCAAGCGCATCA
AACCCCATTGCACCGTGGAGATTCATATCACCTCCAAACGATTAAAGTGCAGCAATACCCGCAGCGTGGCTCTTCTCGTCGTTTCGTCTACATGAAGCCC
ACAACGAGACGGCAGTGACTATCTCTTCACGCTCAGGAGAAAGGCTCGGCGGTGTCGTGTTCTGTAGTACTTGTCTGTCTGTGTAAAACCCATTTTATAT
ATCCAAAAAACGAATAACCCAATACCAAAATAACCCATTTATAGTAACTTGGGCATGAAGCGTGGGAACGTCCGCAACCAGGAGGTGCGTATCCCTCTCT
GTCTCCCCCTCCTCGCTGTACCGACGGGCTTTTTCTCGGATGCGATAGGTAGTCAAACTCATCGTCTATCACTTCCACCGCTTTTCCGCAGGTTACGGAC
GAGCAAGGCCGCCGGCGTTTCCACGGAGCCTTCACGGGCGGCTTCTCTGCTGGATACTACAACTCCGTGGGTAGTGCGGAAGGATGGACGCCACAGACGT
TCTCGTCTTCTCGGAGCAATCGCTCGTCCCAGATCCAGCAGCGGGCTGAGGATTTTATGGACGAGGACGACGACCCGCTGCTGGGCAAACGACTGGAGAC
CACGGAACGCTATGACACGCTGCAAAAGGGAGCCAAACGACAACTGCAACAGCAGCAACAAGTTGGCAAAGCTGGAGCTGCAGCTATCCCAGGGTTCGCC
TTGCCGGATGACTGGGTTCTGCCGGTGAACGACTCCGTTGGAGCTAAGTTGTTGAAGCACATGGGGTGGAAAGAAGGTCACGGCATCGGGCAGCGAGTAC
GCAGACGCAAGTACGAGGAAATGGAGAAGGAGGGAGTGGAGGGACCGAAACTATTGATGCAAAGTGCTCATGAAGAGAAAACAGAGTCAGAGCCGCAGGA
TGAAGAAGAGGTGTACGTTCCGCCACGGAAAGTGTTTGACATTCAAAAGGCTTTTCCCAAGCCCAAGCTGGATCGGTATGGCGCGGGATTTGACCCGTAT
ACGAACGCTCCCGAGTTTGCGTTCCACAAGCAGCAAAAGGAGGAGAATCAGAGAATGAAGGAGGGGTCTCACCGTCAGGTGGTATCCTTTTCAGACGCTT
TGAAAGCTTCAAATGGCAGCAATCGCGCATCGGGAGGATATGGACTGAGCGCGCTGGAAGAAGACGACGACGTCGATGTTTATGGAACTGTCTCAATGAC
AGAATTTGATCGGGTAATTGCCCCACTTGGAGCGAAGAATGACATTAAGCGGCTGGATTCATCAGCACTACCCGCGCGTCGGTATGAGAAGGCAAGACTC
AGTCGAGCTTTGTGCTCAGATGGACGACCTGTCCTTCCTGGGTTTGAGTTAGCAACGTCGAAGGAAAAGCCTCCGAAGGTAGTTAAATTGCGTCTCACTG
TGCCGTCGGATTTCAAGGCCTTTCATCGCTTTGATGAGGAAGGAGGGCGCGATGATGCCGTAACAGCGTTGTATCGCAAGCATAATTTCTCCTCGGGTAG
CGGTGGAATGGTTGTAACAGCGAACCAACGTGGCGTTCTCCTGGAAGACCAAGGGGGAAATGGACGTAGCAATGCTGGCGCGGGAGTTGGTAGCGAGGTG
AAGGGCCCAGCTGCGAGTGTGTTTGACTTGCTTGGCGAGGAGCAGAGGGCGAAACTGTTCGATGCTGCTGCTCAAGCGAAACAGGGGCTACCTTCGTCCA
GAGTTGCACATACTACTTCAGTCAAAGAGTTAGCCGCTCCGAAAGTTCGGCAACCACTTGTGCGTGGTGGTAGTGGTGACGACCAGTTTCGAGCAACGAT
TTCAGCGTCGATTGCGAAACGATTCGTTTCGTCAAAAGGTGCAAGCGACGAGGAAAAGAGCAAGCCTGATCCTACTCAAGAGGTTCACACGAAGGCGTCA
CGCCGGTCGCAGAGTTTGTGGATCCCCGAATCACTTCTTTGCAAACGTTTCCACGTAAAATGTGCCGGACCGACTGGCTCTGGGGTGAAAGATGACGATA
GCGACAAGAAGCGTGACCTCTTCGACAAGGAGCTCGTTCCCCATTTAGTAGAATTTGCCGCTGACCGAGCTGCTCATCAGCGTCCGCCAGAGAAGGCACG
TGAAGCTTCGAAATCGGGCAAGGTTGCTGAAGATGAACGCGTGCTGCCACCTTTACCTGCAGTAAAACGAACCTCGGCCAGTCTGCTCAAATCGATTTTC
GAGCCGTCGGATGAGTCTGAATTGAGTGACTACGATAGCGAGGATGAAGAAGGCGATGACGGCAATGTAGAAGAGATGGAGAAGCAAGATTCTGCCTCGA
GCTTTCCCATCGGGAGTGCTGAACAACTAGTGCGAAATCATCAGCACGACCAACGTGACGTGAGCTCAGAGTCAAGCTCGTCAGAAGATGAGGTTGGTGC
TCACTCCTCGATGCTTGGCGCTAAAGTTGGCAATAAAGAAGATGACCGAGGCATCAAGCGACTGCGCAGTGAAGATGACACCGACAATGGAGATGCGAGA
CAAAAAAAGAAGGACGAGAAGCGGAAGCACAAAAAACACAAGAAACACCACAAGCATCGCTCGTCGCGTGACGACAAGGACAAGAAGAGGAAAAAGGACA
AAAAGGATCGAAAGTCGCACAAGCACCGCTCCTCGAGACACTCCAGGCGAAGCAGAAGTCGAAGTGGGGAACGAAGCTCGGGTCACCGTCGTAGCTCCAG
CAAACAGCACTAGCAGTAAAGCTGGAACTTCAGTTCTCTACTAACAAGAGTACTTCAGTAATGGAAGGAGTAAACCGACGCTGTTGACACGGCGGCATGG
CGATTATTTCGCGTGGACTAGCCCAAGCACTTCAACTTGAACACAAAAAACGAACAAAACATTTTTGAGTCTCTATGTAAACAGAATCGATTGAAGCTCA
AAGCAATGCAAAAACTAATCAATACACGACAGAGGGCTGGCCCCTCTACCGAGTCAAGCACCGTTGCCTGGCGCTTAAAGCGCATGTGTCTCCCTGTGTT
CGTAATCCTGGCCTATTTGAAAGCTATCCCGCTCACAGCAGCCGCCATTAAATTAGTCGAAGGTCTTCTTGTTGCCCTGGAAGTTCTGGATGGACGACGG
CTGGCGTCTGGGGGGACCATCACCACGGCCACCACGGCCACCGCCGCGACCACCGAAGCCACGGCCACCGCCACGGCCTCCGAAGCCACGGCCACCACCA
CGGCCTCCAAAGCCACGACCACCGCCACGGCCACCATCAAATCCGCCGCGGCCTCCACGGCCTCCACCACGGCCGCCAAAACCACCACGGCCACCGCCGC
TGTGCTGCTCGCGGCTCTTGGCGTAGTTGACGCGAATGGCACGGCCGCTCACGTACGAGCCAGCAAGCTTCACAGCCTCGTCGACGGCCTCAGTCGTCTC
AAAGTCAACGTGGCCAAAGCCACGGAACTCGCCAGTCTCACGGTCCGTGGCCAAACGGCAGCTGAGGATTTCACCACACTCGCCGAAGGTTTCACGGATG
GTGTTCTCATCCACGTCCCAAGACAGGTTGCCAATGAAGACGCTCGTGCAGCCCTCCGGCTTCTCGTCGAACATGTTCTTCTTCTCGGCCGTGCGGATTT
TCATCCAGCGGCCTCCAAAGTCTTGGCCGTCCATGGCAAGAGCAGCCTCAGCAGCCTCCGGAGTAGCGAAAGTCACGAAAGCAGTACCCGACGAGCGGCC
GTTCTGCAGAGGGATGCGAGCGCCAGTCACCTCACCGCATCCGGCAAAGTGCTCCGTCACCTCCTCCTCCGTGGCGGACCACGGCAGACCGGCAATGAAG
ACCTCAAGGTTCTTCTGCGGGTTGGCAACAGCAGCGGCCTCGCCGTCCTCCTGCTTGTGGACCTTGTTGGACTTCTCACTAGCGTCCGAGTTCTTACGCT
TCTTGGACACAATAGGGGTCTCCTCCTCGTCCGAGGACGAGTCCGAGTCGCTGGACGACGAAGAAGACTCCTCCTTCTTGGCAGCAGTCTTCTTGGCAGC
CGGCTTCTCAGCCTCGTCATCCGATGAGTCCGAGGACGAGCTGTCGCTGTCCTCCTTCTTAGCGGCAACCTTCTTGGCAGGGGCAGCCTTCTTGGGAGCC
TCCTCCTCATCAGACGAAGAGTCCGAGCTCGAGTCCGAGCTCTCCTTCTTAGCGGCAACCTTCTTGGCCGGGGCGGCCTTCTTGGGGGCCTCCTCCTCAT
CAGAAGAAGAGTCCGAGCTTGAGTCCGAGCTCTCCTTCTTGGCCACCACCTTCTTGGCAGCAGTCTTCTTAGACACCACCTTCTTGGGGGCCTCCTCCTC
GTCGGAGCTCGAGTCGGACGACGAGCTGTCCGAAGCCACGGGCTTCTTGGTAGCGACCTTCTTGGCCACCACCACCTTCTTCTGCGGGGCCTCGTCGCTG
CTCGAGTCAGACGACGAGCTGTCGCTGCTGGACGCAGGCTTCACGGCAACGGGCGTTTTCACCTTCTTGGCCATCGTGTGTAGAGCAATTGGAGAGTCGG
GAGCTGTCGGGGCGTCGAGCGATTGGCAAATGACCAGCGAAACACTCGCACAACAGGCCGTTGGCTGGGATACCTTCAAGCGTCAGCACCGGTTTGGTTG
GCTGCCGCGCTGCATGGTACACTGTGCCGCGTTTCATGTGAGCCACACGAAGTGTGTGGTGCACATGAAGCCAGTTCGTGAGGTTTTTTTCCCTTTCTCC
CCGAGGCTTTATGTGTGGCGGGTGTGGCCCCCCACACAACGACCACACAGTCTTTCTTTCGAAATCCGGCGCGCGAATAAATCCTAATAATGGTGGCAAG
TGGCGACGAGAACGTGGCGGTGGACGTGGCGGTGGACGTGGCGGTGGAGGACGCGACCAAGGTCGAGCACGAGCCGGTGGTGGGTGAGAAGCGCCACGAG
CGCTCCGAGGACATGGACCCGCTCGTCCCGGACGTCGACGTCGACGTCGACGCCGCAGCCTCACAGGACTCGCAAGCGACGCAGGACGACGACATCCAAG
ACGTTGTGGCTAATATCAAAGAGGCCACGGCCGTCGACGTGACGTTCGACGCCGCCGCCGCGGCTGCAGCCGTGGTGCCGCCCCCCGAGGTCATGAAGAC
TGACTCGTCCACGCCCGTGCAAGACGCAGTCGCGGCGGCCGCGGCGGCTGGCGTCGGCGTGGACCCGAACGGTGCCGCCAACGTCAAGTTCGACAGCAAG
CGCATGGCGCGCGTGTCGTTCAACTCGTGGTTCGACTTCGACGCGTACTTTGAACTGTACATGCAGGAGACGTTCCAGCCGTTCCGCATGCGCTCGTCCT
GCAGCGTCGAGGCATACCGCCGCAACCAGCAGAAGGTCATGCTCAACAACAAGAGCTCACGCGGACGCCGCGCCGAGTTCCCGGACGAGGCCATCCACCA
CCACCGGATATACATGTGCACGCACGCCATGAAGGCGCGCTGCCGCGGCGCCAACACGCGTCCTGGGCAAAAATACCGCGGTATCGGCTGCATGGCCAAG
ATCAACGTCAAGATCACCCCGGCGGACAACCCGTCCAAGTACATGGTGATCGTGACGGACCAGGTACGAACGGCACCCGATTTGCTTGGTTATTTATTGT
GATTTGAGATTGACCCGTTGTCTTTTGCTATTGGTGCTGCAGGTTGTGTCGCACAACCACCCGGTGAGCCGCGAGATTTATGAGGCATATCCGGATGTGC
TGCTCAAGATGATGCGGCGCAGCCAGCTGTCCCAGTCGATGCTGGGTCACCCGCCCCCGCCCAAGTTTGAGACGCCTCAGCAGACGCAGAAGTACGAGCG
CGCGATGAATACGTTCCAGTCGATCGCCGAGACCATGGCTCGGCTGGCTGACGAGGACTACGAGCAGCAGCTCGGGCAGCTGCAGCGGCTCTACACCCCC
GCCACGGAGCAGGATCAAACGGTCTGAGTATGAAGTCGCGAGAGAGGCGAACGGTGGCTATATACCAATACGCGATGAGAAGAGGCTGCCAGCGAGATTC
GATTTTTGCTCTTGCTGTGTAGCAACGTTCATGTCCAGCATTCATGTGCACGCTAATGCATCGTTGTCACTTCACTGTGGCTCATGGGTACACAAGTTTT
ACTACATCCACAAAATTTGATTACCTTTTTGTGTATGCAATGTGTATCATTTGTGTTTGGTTTGTGTACCGAGGGGGAACTGAGAACAATACACGACATC
TGCATCGCAGCCTCGTAACCGAAGCAGCGATGGCGAGCAGCGGCGTGGACGTGGCGCTCGCGCCCAACTCGAGCGTGATTCTAGAGCCGGCGGACTCGCT
GTCCTTCCATCTGCAGCCGCAGACGGCGCCCCAGGCGGTATTGACGATCCGCAACGTGGCGGACGACCGGCAGATCGCCTTCAAGGTCAAGACGACGCGG
CCGCTGCGGTACCTGGTGCGGCCCAACCAGGGACTGCTGGGGCCCAACGGCTCGGCCTCCGTCATGGTGATCCTGCAGCAGAAAGACTGTGACGAGCTGC
TGCGACTGGACCCGGCCGAACGCCAACTGGCCAACGACAAGTTCCTCGTGCAGAGCATCTACGTGGACGACAGCTTCTACGAGCTGGTCAAGACCAAGTC
CACCAAGGAGATGGCGGACGAGCTCACCAACATGTGGGCGCGCACGGACAAGCGCGCGCTGTCCAACAAGAAATTGCGCTGCCGCTTCGTGCAGGACAGC
GAAGAGTTGGGCCGTCCGCCGTCGCCGCCGAGTCCACAGCGAGCGCCGTCGGCCAGCGCCTCGCCGGCCAAGACAGCGACCACGTCGGACATGAGATACC
AGAGTAGACAGAGCGACGAGGTCGGGGACGAGGTGGCCACGCCCGCGCAACTGTCGTCGGCATTGCTGCAGGACGACAAGCCGCAGGCGCCGAAAGTGGC
GGAGAACAGGGAAGGAGGCAAGGAAGCGATCCAAGAAGTTGCGGCACTTCGGAAGAAATACGACGAGGTAGGTGCAGGGTTGAGGTACTGTGGTGACGAG
TGGGGCTAATGGAGGTGCGTTGTGTGCTTGATGGTGCTCAGTTGGTGGCGTTCACAGTGCAGCTTACGGCTCAGCGCGACGTGTTGATGAGCGATCTGGA
CAAGACGCGGCAGCTGCTGCAGAAGGCGAGCACGGATGCACAGCGCGTGAAGAAGCTTTCAGAGGAGTCATCGACTCTGCGTCATCGGAAGAACAACGGA
AACGGAGCTTCTGGTACGGAGGACTCGCAGGCGATTACGGGAAAGGGTCCCAAGGAACAAGGGGTACGTCTTGGCTCATGTTGATACGATAGGCTATGCT
GGCAACTGACAGGTTTTGCTGTGACAGGCTTTTGGACCCTTGCACCTGCTGGTGTGCGCGATCATTTTCTTTTTAGTTGGGCGCTACTACTAGGCAACTT
GCGTGCTACGTACGTACGCTGGAGTTAGGCAGAGACAGAAGGTGTTGCTGATGAACGAGGGAGGCAACAGCACGCTTGAAAAAAAAGGAAATTGAAGCAA
TAGAGCTTTCTGTCGAGCTGCGTGAAGACGCTGACTCGTGTTCACATGTGTGGAAGTAGGCCGGTAGTGCAACAATCTTGGTTACTTGAAGTAGACGAGA
ATCATATAGTAGGAAGAGTACTACGTAGTAAGTAGACCGATTCCGGACAGGAACCCTTCGGGCCTCTTGGTTCATGGTCAAACTGTCAAAAGTATTCGTG
GAAACGAGACTTGCAGTGAACTTGATGGTGCATTTGATAGCGGCAGATGGACTACAAGTTACTCGTACAACGCCCTCTTCTTGAATGTCTAGATCTGACG
GATTGACATCGGCAGTGTTGCTGCTATAAAGTCGGGTTGTGCTGATGTGTGGCTAGTTGAGAATTGCTGTGACGCTCATTTTGCGCTTGCCTTCCATGTC
TAGCGGCGCGCAGGCCTTGCGCTTAGCATTCCGAGTGCGGCAACTTTCCGCGGCACTGTCACCGCCGTCGCTGCTGATTCCAGACGCGTGCAAACCAGCG
CTGTCTTTCATAGAAAGCATCGCAATTGCAGCTGCATCGCTGTCCGATTGGGTACCGGCAGGGGCAACACGCACTAGCACTGGAGGCAGGATGGGCTTTT
CTTCCTGGGGACGACCGGCAAAGCGCAGTGGCGGCACCTCAGCATCATCGTCAGGGAAATTTGAGTCATCCGGATTGTCCTCGTACTCTCCATCGCCGTC
ATACGCGCTCTCAATCTTCCGAAGTTGTCGTACATCGTCGCGAAGGGCGTTTACTCGTACGAGTGTGACTGAATCTTCTGACCGTGGTGAAGCTTCATCC
ACTGAGCTTCTATACCTGCGTCCGTCATGGCGGCTGCCACTTGCGCCGGGTGGAGTGTGACTTGGCGAATGGCTTGATGAGTTATTGTTACCAGAAGACG
TGTCATCACCGACATCACCGCCGCCTGAGGTGGGGCCTGAGCTGCCGGGTGCCTCCCCCGAAGGTGAGGAGGACGAACTACCGCCACCACCACTGCGTCG
AGAGGACGACTTTTGCGCATCGTGCTGTTCGATACTTGAACCCGTTGCCTGCATGAAAATGTGCTCAAGGCGGTCGATCATTTGCAGCAGCGGCTCATAC
GTTGCGAAGGGCTGCTTCATCAGGATCGTGTGCATGAATTTGTTGCGTGTAGCATATCCCGTCCACTTGTCGTGCTTTTTCAAGATCTGAATGGCACAAC
GCAGTAGGCAACCAGACGTGAGTCAAGTTGCTTCAACAACGTCAGGCAGACGGAAACGCTGCCAGGGGGACGAACCGCCTGACTCGACGCAGCGGTCAAT
ATAGTTAGGATCCGACCTTGGAAATGCCGCAGAAGTTCATCACGGCGAAGTTTTCCAGCAGCAGCAGCTCCTTGTACAGCGCCACGCAGTTTTTCATCAG
CGCTGTTTTGGCTTCCTCGGATTCTGGGTTCGTCTGGACGACATACCGCGAAATTGACAGTTAGACCTCCACGCTAATGTTTATCAAAAAAGAATTCCAG
CCCCATCAACAGCATTTCTCTTTTCAAATACCTTGAGCTGCTGGAAACTGGCGTCAATGGCTGCCACCTGACTCGTGTGTTTGGCCTGCTCCTTGATGAA
GAAATCGGCAATCTTCTTGATCTCCACACGCAGCGTCCGGAAGAAGTTCATTTCATCCTGCGACTGGCCTGCTCCAGCAATCAGAACCAATAAGAACCTG
TCCATCAAAACGACCTCCGCGCGGCACTCACGGATGCTGTCGTTGTCCTCCTTGGCGGACGGTTTGATCTTGATTTTCACGAGCTTGTCGCCCTGCAGCT
TCTCCTCCTTCTTGATCTGCGCGCAGTCCTTGATGATCTTCTTGAGCAGCTTATAGTCGGCCCAAAAGGGCTCCCAGGCCGACGGCGACATCTGCGTCGA
CTGCTGCAACACTTTGCCGAACTTCATTTCGACCTCTTCACTCCTAAAACGCAATCGCGGTCTGAGCAGACAAAGCAACTGATAACCAGTCAGCGGGCAG
ATTTTGCTCTTCTGCAGAGCGCGGCGGAGCTGGCAACTGGCGGCGAGATTCGATGCAGAAACGAGGAGAAACCACCTGGTCGAATCTTTTCCGTCGCCCG
CAGCAGGAGGAAGAGCCCGAATCTCCAACGCGGACATTGCGCTCTCCCTCCGTCGCTTCGCCACTTCTCACGCAAGCACATCGTGCAGACTTACCTGTGG
GCGCTAGTCGCAAAAGCTGCTATGTATGGCTACGCGGAGCCGATCGGTTATTGTCTTGTGTGCTGCAAAGC