Description :
From Genome Similarity Track
Location :
Scaffold_255:37656- 40243
Sequence
2587 bases(100 bases per row)
ACGATGCCACGTCTAGCATAGTTGCTTACTCGCAAGGCAATGTGCTTTGCATTGATCGATGAAGCTTTGCCTTAAAGTTGCTTGATGGCCTCCTGATTGT
CGACATGCATCAGCATGGGTAGAACCGGCGCCATATGTATCTCGCAAAGCATCTCGCGCATACCCAGCAAACTACTAGAAGGCTCAGATGCAGCAACGAA
CTCTGCTTCCATTGTAGACAGGGAAACACCTCCCTATTTATTTGCGCTCTAGCTTACTGGCATGCCATTTATTAGTATGACATATCTTGTCAGCGATTTG
CGATAATTCTTGTCTGCCGAAAAGTCTGCATCGCTGTGTGACTTCAGCTTAATAGTCCCATGCGACCCAATTGTCGGTGTAATTAGCAGTTTCATTCCTT
GAGTTCCTTTCAGATAGCGCGCAATGCACTTCTCCAGCTTCCAGTCGTGGACGCGTGGCTGGTGGGTTTGACGTGTAGCTTTGTGCACCGCAAACGCCAC
ATCAGGCGGCGTGCATCGCGCCAACCACAGCAAGCTCCCAACGAGTGACTGAAAATACTTGATTAATGGCAGTCCTGCCTATTTTGTCAAGACCAAGAGC
TTGCTACCCTCGTCCGCGCCAATCGGCGCTAGCGTAGAATTTGCATCCGCCAGCCTGTTCTCTATTAAAAGCTCCCAAATTGCCTCCTCCTGGTCGAGGA
CATACTCTCTGTTGCTGTCAAGGGTTGACGCATATGCCCAAAATTTTTGACACACGTCCAAAATCCTTGATCGACAGTGATTCGGGGCTGACGAGAGACG
ATCAACTGCTTCTGTGCTGGTGCCGGTCGCCAGAAGGTCGTCGACATGTACACCAACCACGATGGTGTCGTCGCCGTCTTTTTTGCGGTACAAACACATG
TCCGCGCCACACTGTACAAAACTATCCCCTGTAAGCTTCGTGTGTAACAACTGACTCCACAGACGGTCCGCTTGCTTTATTCCATCCAAGCTCTTGCGTA
ATCGCAGTACCAAGTCGCTTGTCCCCCTCGCACCATGTTCCTGGAGAATCTTGTGGTCAACATTCGTACCTTGAGACACTTATAGATAAATCTCGAGATG
CTCTTCTTTATTCGCCTTGACATAGGCGCTCGGAATATCACCGTGCTTTGTAGGTACTTTCCACGTTACCGCGAAGGCCAGTATCACCTTCACGGTTGAT
ATATCCACAACAGCTCCGAAAGTCAGACTGTTGTCCACGCCCAGAACTTGCTCGTTCCCGTACGCGACCAGTCGGGCCTTGTACCGTTGTATGTCGCCAT
TCGCGTCCGTCTTTGTTTTGAATACCCACTTTGTGTACAGATCATTGACGTATTCTGGACGTTATATCAGCTCCCAAACGCCATTAGCCTCGAGTACCTT
CAGTTCTTCACTCATTGCGTCCTTCCAACTTGTACAATTTGAGCTTCGAATCGTATCAGTGTAGTTCTTTGCGTCACGTTCGAAAACGTGACTCGCAACA
CTTGCATCTTCGATCGGCTCCTCCTGATCGACGGTTTCTGTTGCTCGTTTTGTCTTTGAGCGCGTGAGATGCCCATCTCTTTTCCATGGCTCTGTCGGTT
ACTTTTGATTTCAACTGTTGTCGTTTCGACCATGCTAGCTCTGAACATAGCTGAGGCCCTCGCCTAATCTTCAAACATCAGTCCGCGCTGCAGTTGATTG
TTCTGATCCTTATTCAGTGTTTTGATATCCGTAACATGATGTGTTGTGACGACCTTGTTGTCCTTCTTTAAGAACACGCGATATCCCTTAATTTCATTGC
TGGCTCCGATGATAACGCCAACCACAGATCGCTGCTTTAACGAGGCTTTCCGCGGGTCTCTGTACACGGAGCAGATGCTCCCAAACACAACTATTTTCCG
AAGATCAGGTGCATGATTTGTCAGAATCTGGATTGGAGATGCGCGTGCTTCATTCGCTCGAGTCGGACTCCGGTTTAAGATATATGCTGCGTACTCGACA
GCATCGCCTCAGAACTTCAGCGACAGTCGACAAGCGACGATCATGCTGCGCGCCATATTAAGGATCGTCCTATGCATGCGTTCGGCCTTGCCACTCGACG
CTTGGTTCCTTGCTTCAGTGACTTGACGCTCAACTCCATTGAGCTGGCAGAATAGGTCAACGTTGTTGTATTCGCCACAACTGTCGGTTCATAAAACGTG
AATCTTGCAGTTGAACCTCTTCTCGAAATAATTGAGAAAGTACTCAAACTTCTTTGCTGCCTTGTCCTTTGTTGGTGCCAAGAAAACGCGGCAGTAGTTT
GACTTGTGGTCCACGAAGTTGACGAGGGTGCGATTACCGAGCCTATCCTTTGGTGTCAGTGGACGTTTTAGGTCCTATCAAATCACTCCGCCAATCCGGT
CAATCGGAGCATGCATTCCACTGTCGATCTGCGACTGCTTGTTCTTCAGCTGCTTTCCTACTTTGCGTGATTTGCACACCGTCCGTTTATGGTCACTATT
TTCAACCCCCGATCCTGGTGTCTTCGCCATGCGCTCGATCGTATAAAGAGATAGATGTCCCATCCTAGCGTGAAACTGCATCAGTGA