Description :
From Genome Similarity Track
Location :
Scaffold_1404:3765- 4955
Transcript NameFunction/comments
Phyra_86955taurine dioxygenase, putative

Sequence
1190 bases(100 bases per row)
TCAATTCACAGCCGCGGGCTTGCCGAACCAGTTTGCAGCTGTCCTTATGTGATGTCGATAAAAGCAACATGCCCATCACTGGTATCATTTGGATAGTCGA
CGGTCTCTGCTGAGCCAATGCGAAGCGCCCAGGATATCACGCTGTCCATGCCCCCTACCAATTAGCTCCGCGATCGAGCACCTATCAGCTCCATCATCTG
CGCGGAGCAACCTACAACCCAAACGCCCACCAGAATTCCTTTCGTCACGGAAGCGCTCGTGCGTGTCTTTGGCGTACGCGCTCGCTTTCTGTTGAGTGAG
CGCCGCACGAAGTGGGCCCATAGCTAGCGTCAACGAGTATCTTGCGCAACACCAGCTGCCGTGCTGCGATACTGAGCACCAATCCAAGTTCAAAGCATCC
GACGCAAGTCGACCTTCGCTCGAGCTAACTCGCCCGCTGCCGTTGCTCACTTTTCAACTTGCACTCAAGCGCCATGGCCCCCATCAACATCGACTCCACC
TCCACCACTGCCGGACCCACTGCCGCGGTGGTAGTCACACCAATCAAGAACGCGCTCAACCAAGAGGTCGAACACGCACCCTTCACCCACCCGGAGCTGC
TCGGAGAGTTCCCCACCAAGACGTACGATCCGATCCCCGTGCTGCCGTACAACGACCGCGCGCTCAAGGCCGATCCGTCGTTCAAGAACCTGCTCGCGGA
TGCGACGGTGACGCACTTGGAGCCGAAGATCGGCACGGAGATCTCGGGTCTGCAGCTGCACGAGCTGACGGACGCGCAGAAGGACGAGCTGGCGCTGCTG
GTGGCGCAGCGCGGCGTGGTGTTCTTCCGCGAGCAGGAGATCTCGATCGAGCAGCAGTTGGATCTGGGTCGCTACTACGGTCCTCTGCACGTGCACCAGA
CGGTGGCTCACGCGAAGAGTATCCCGCAGGTGCACGTGGTGGAGAACTCACTCGAAGTTAGCGAGAAGCGCCTAGAGACTCAGCTTTACAGGCACTTCAA
CCAGTGGGTTTGGCACAGTGATGTGTCCTATGAACGTCAGGTGTACTGCGGATTCTTTCGTAGAGTGTACCGAGTGCATTTACTGACAGACTATTTTTGG
TTGTTGTTGTGTGCAGCCACCTTCCTACACGAGTTTTAAGGTCTTGACAACGCCATCCACGGGTGGAGACACCCTCTGGGCTTCTGCATA