Description :
From Genome Similarity Track
Location :
Scaffold_13:376318- 377561
Transcript NameFunction/comments
Physo_130883reverse transcriptase
Physo_108514polyprotein

Sequence
1243 bases(100 bases per row)
CAGCCTCCATGTTTGCGCTCTTGAAGAAGAAGAACAAGCGGAACGCCAAGATTCATCTCAGCGACGAGCAGCTGAAGAACTTCATGGAGTTCAAGCGGCG
ACTGTGCAACCCGCCAGTATTGCACTTGCCGGATTTCAGCAGCCCCATGCATCTGCGTACCGACGCAAGCAAGTTTGCTGTCGGTGGAGTCCTTTTTCAA
GTGGTGGACGGAGTTGAGCGCCCGATAGCGTACACAAGCCGGAAGATGAAGTCGGCGGAGCTCAACTATCCGACTCAGCAGCAGGAACTACTAGCGATCG
TTCATGCGCTGGCAGCGTTTCGGATCTACTGCCTGGACAAACCACCCATCGTCGAGACGGATCACAAAAGTCTCGAAGGACTGTTCACCCAGAAGATGGC
CAACCGACGACTCGCTCGCTGGTACGACATCCTTGCGGAATACCAGCCGACGTTCTCGTACCTTCCCGGTGCGAAGAATGGCATCGCAGACGCGTTAAGT
CGAAGGTTAGACTTACAACCGGAGACGAAGTTCTTCCACGACTTACGGGTGACCAGCTTCGACAGCACATCCTTCAGCCTCGCGATCAGCGAAGTAACGG
GTGACTCGGAGCTGATTACGCGCATCAAGAAAGCGTACAAGAAAGATCGTGATGACCAAGCAATCTTGACAGCAATCAAGCGACGCAAATCCGACTCAAA
ACCAAAGCGCGAACACCAGCAGCACAAGAAATACCGCTGCTACTCCGAAGCGAACGGGTTACTGTGGTATCAAACGCCTGCAGATGACGCTCCACGGATT
GTCGTGCCCAACGATGTGAAGTTGCGACAGACAATTATCAGCGAGTGTCACGACACCAACTGCGGAGGCCATCCCGGTGCGGAACGTACGTACTTGACAC
TGGCGCGCCATTGGTACTGGTCAAAGATGTTGAAGTCCATCCAGAAGTTTGTCGCCGACTGCGAGCCTTGTCGGAGGAACAAGCCGCGGTTGACGAAACC
TCCTGGATTGCTCGAGCCACTCAGTATTCCAGACGAGCGTTGGAGATCCATCTCCATGGACTTCATCACTGATCTGCCGCGAACGGAGCGGGGCGTCGAC
TCTATCTGGGTCGTCGTCGATCGGTTGACCAAGCGGTGTCATTTCGTGCCAACCACCAAGAAGGTGAACGCCGAAGGTGTTGCTCGACTCTTCATCGACA
ACATCTGGAAGTTACACGGCATGCCGACGAATATCGTCTCCGA