Description :
From Genome Similarity Track
Location :
Scaffold_110:3762- 13330
Transcript NameFunction/comments
Phyag_g2183conserved hypothetical protein
Phyag_g2184structural maintenance of chromosomes protein 5, putative
Phyag_g2185hypothetical protein

Sequence
9568 bases(100 bases per row)
TATTCTCTATTCGTGAGGCAGGCGGGGGATCGGAATCCGTAAGAAGTCTGATGCAGGCACAaccgctcgtcgtccaaACGATTCTTGGGCCTCCACTGCG
AGATGAAGTGTTGACCGAGCCTTGAAGTCGGCCGACCAGTGCCGGAAGCGATGGCTAAAGTGCGTCAACGCGAGTAAGGTTGCATTCATCTTTTTGGCTG
CGTACCCTGCCATGCGAGCTGTCGAGTGTCCACGCTGCACTGCTTGCTTCATCATTGAATGGCTTAACGTTGCTTCATGTACCAAAACCTGCAAGAACAA
GATATCACCGCATACAAAGAGTGAGAAATCTCGTTAATATGCTGCACTCAACTATACAGTGATAACATACATCGCAGTTTTGAGCAATGTCAAACATCCG
TGAGGAATCGGCAGAATCGCCCAGGATGGCCACCTTGCGTCCACGAGCCTTTGGTCCAGTAACCTGTAAAATTGCAAATGTGGATGAAAGAGTTAGCTGG
CGTGCAACGTGCACCTGTGCAGTCGACTACAACGGGTTAGATCCACCGCCTACAAACCTCGGATGCGTGGAGAATTTCACCATTAGGCAGCTCGACGTCC
CCTCCCAACTTTAGAGTCTTATATTTCGGTCCAGGCGGTAGTCCTCGTTCACGCAACGCGTTCAAATTCAGTTTTCCAGGAACAGGATACTCCTCAACGA
CGTAACTATCGAGTTCATCACAAAAAAAATTCCCGTCAGACCATAACAAAAAGCAATATGAAAATGCAGCAATAATAATCCTTACCCGAAGCTCGTGACC
GTGTGCTTTAACGTAGCAGCTTTCACCATAAACTTACCATCATCCAGTACGTTCCAAACATCACCGTTCCCATCCGATTCCGCATGAACCCACTTGCGCT
TCAGACTCTAAAAAATACCAACACGTAGCAACCAACATCAGCTTCACTATCCACTCACTCCACCAAATAACCCGCAAACCCACAGGATGTTTCGGTGCGT
TGCGCATGAATTTCTCATGCGCCGACGTCTTGCTCAGCATATCAGGACACACCAACTCGTGCACCGTAATTTTCAGATTCGTGagcctcgtgctgctcgt
cgagaAGGCCGTATTTAAATACGAAAACAGCCCCAGCGGTCCGTAAACATCAATAGGTCGTGGAGCACTCTCCTTCGTCTGCGGGTCCTTGTACTCTGCG
TTGTGGTTGTCCAATGTGCACAGGATTCCAGGCAGTCCGTACACGTGATCGCCATGCAAGTGCGTCACAAAGAACTTGGTCGTGAGAGGTACACGCACGA
CGCTCTTGATCAACTGTCGCAAACTTCCTTCTGCACAGTCGAACATCCAATTACTACGAGCCAATCGCAAGCAAACGCCCGTCGGATTGCGTCGCAACGA
TGGAGACCCCGCTCCAGTGCCCAGAAACATCAACTCGAAGCCCGTAAACGGCATCTGCGATGGCGGCACGAACAAATTATTGCAGCTACGCATAGGGACC
GTATTCATCACCGCATGACGCTCGCTGATGTGCGTCAAAGGCGCCGTACGCCACGCAGCCCGAgccaccagcttcgacgccatcaccaACGTGCAATTAT
GATGGAATTAATGTGGTGTACACTACTTATCCTAAAATCCTACTTTAGTGTACATACAAATTCCAAGTGTAGCAGTCTTAATCTAGGATTCAAGGACGGA
TTGTCCTAGTTTTAGAATTGTTTTTTTTCGCGGGAAAAGCATTTTGGAGGCAGGCGACGATGGCCATGGGCGACGTGCCCGTCTCGAGCTCGCAGGGCTC
GGACGAGTACGTGGACGGCTCCATCTACCGCGTGAAACTGCACAACTTCCTCACGTACTCAGACGCCGAGTTCCACCCTGGTCCGCGTCTGAATCTGATT
CTGGGTCCTAACGGAACGGGCAAAAGTTCCATCGTGTGCGCACTTTGCGTCGGTTTGGCCGGCAGCACTCGCGTACGTCTCATAATAATATAAAATATTG
TGTTATTAATTGAATTTAATGCAGCTTTTTTTTAATGTTCTTTTGTTATTATAGCTGCTGGGGCGAGCTGATAAAGTGGGGCAGTTTGTGCGTCACGAGA
AGGATAGTGGATACACGGAGATCGAGTTGTACTTCGCGAGGGGCAATAAGGTCATCCGCCGCAATATCTTCCGAGACAACAAGAGCACGTGGCAAGTTAA
CGACAAGGACTCGACGCTGAAAAATGTGGCGGGAATTATGGAGGCGGCTGCTATTCAGATCGACAATTTGTGTCAGTTCCTGCCTCAAGATAAAGTGGGC
GAGTTCTCCAGGATGAACCCGGTGCAGCTGTTGAAGGCCACGGAGAACGCTATTACGGACAGTGACTTGGCAGCCAAACATGAAGAGATTATTGAGTTGC
AGCATAGCATGTCGGACAAAGGGCGGGTAGGTTGTGATAGAGGCGCAGTTGAGAAGTTGCAGATGCTGATAAGAGTGGTTTGGctgtttttgttgttgtt
atgTAGGAATTGGAACATGCGCGAGCGGCGCTGGAGTTGAAGAAAAGTGAGAACGCTCAACGacagaaggaggtggagagaATTGAAGATTATGAAACAC
GTCTTGAAGAGGTGCAGTTGTGATGGCAATACTTTTTTTACTGAAAAAGGTACGGTTTGCTTACAGAGTGTGTTTTTGCTTGTGCCGGTTGATCGTTGTA
GACCAAAGTTATGGAGAAGAAATGTTTGTGGCTTGAGTTCGAGAAAGCGAAAAGCGAGGTTGAGGAGCTGAAAGAAGAGAAACGGCGCTGCAAGGACGCT
ATTACGGTGAGTTTTGTGTGGTTATTAGTCGGAGTCGCACAGTTGCTGCTTGTACTAATGAGGGTATATGTGTTGATGCGGAGCAGAATGAACGCAAAGA
GAAGATTGATCCTCTCATTAATCTTTTGAAGAAAGAGTCGATTAAGCTGGAAGATGTGAAGACAGAGTACGTTACATTCCTGTATTCGAGCAGTGGCCTC
TCGTATTGCGCTAACGAAGTGCTTGGCTGTGTTGAAAACAACCAGGAAAACAGAAGTGGATGACGCCAAGCGGCAACTTGTTGACAAGATCCGACAGGAG
AAAAATCACGTGAGTGAAGATCTCAAATTGTCCTGGTTGGAAGAATTGTGTCATAGCTCTAATCTATTTGCCGTTGCTGTTTGGTGTGCAGATTGAATCA
ATGGAAAGCGCCCAGAGTCAAACGTTATCGGACGTCAAGGAGCTACGCAACCAGCACAACGCCACTCGTCGAAAACTCGAGCGCTTAGAACGCGATGTGG
AAGATGTTAGTACTACTTTCACAATTTCCACGCATTTACTCTTTAGTAACTGACTTAACATTGGTTTTACTACACAGTGGCGGAAGGAGCGCGCTGGGAT
GGCTAATGATGCTGATCTCAAAGAGCAAAAGGAGCAACTGGagaaacagcagcgtgcTAAGGATATGGAAGTACGTACAAGCCGAGGTGTTTTGACGATC
ACGCCACAATTCTGTCGTTTTAATGCTGTTGGTACTGGTGTTACTACAGGAAACGGAAATCCGAAGTAAGCGAGAAGCACTAGCGCGTGAGCTATCCTAC
ATTGACAGTGAACGAAGGAAGGTGGCCAGTAAACTGGATAAGCTTGACAACGAGGAtgtccagcgacgactggCACTTCAGAGAGCTGATCCTGATTGTA
TCCGTGCTGCGGACTGGGCCAATAATAACCAGCATCGGTTGAAGCGGAAAGTGTGGGGTCCCATTGCACTCGAGGTGAGCGACACATTTGcttgctcctt
cagcgtaACGTTTTGGGAGATTGTCTTGCTTACACGTCGTTGTGATTACTGCTTCAGATGAAACTCAACGAAACGATGCATGCCAAGTATGTTGAAGACA
CCCTTCCTAAATGGCTTCTGGGTGCGCTGGTTGCTGAGTGCTACGACGATTACAACACTATTCTCCGCGAGTTGAATAGTGGAACCTCGGATCGTCGCAT
CAAAGTCTCAATTGTGATCGTTGAAAATGGAGTATGTCATTCTGTCCACCGACCATACTCGACAGAGCAGATGAGCGAGTACCGCGACAGATACGGCATG
AAAGGCTACTTGGACGAGGTATGTTAGTATTCAACCACTTTGAAATGGTTCAAGCAATTTAACTGACAGCTTTATTTTTCTTTGCCTTGAAGCTGGTGAC
TGCGCCAGACATTATTCACGAGGCTCTTCGATCTCACGGAGGCCTCCACACAGTTATGGTTGGCTCCCAGCAGACTGAAGATTTCATCAACAGAGGTGGA
CAAAttttctccgtcgtcgcatCGTCAGAACGAAAGGCAGCATTCGTGACTCCGTACAAGAAATATGTTACTTCAGGTTTGTAGCGAGGCGACTATATGT
GTTTACCTATGTGGATTTACGTCTAACTATCTGTGCATGCCGACAGTATCCAAGTATGGAAACCGTAACGTGACTACGCGTACGAACGACCTCATGAACC
CTCGATTGCTGGCGGCGTCCACTTCAAACGAAGACGAAAAAACTGAAATGAGAAATATTCTGGATGAGTTGGCATCCAGAGAGAGGATAATCCAAGAGGA
GGTACGGAACTAACTACTGCGCCGCACTTTTGTTGTGAGGAAATCTGCTCATATTAACTGAACAACGATTCTGTTTTAGATAACTGGCCTCAAAGAGCAA
GAGAAACAGTATGTCGAAGAGAAAAGGACAGCTCAACATCGGATTACAGAAATTCGTTCTCAGCGGAAGGCAATCATTCGCTTGGATGATAAGATTGCTG
AGGGGGACAACAAGATATACTCGTTGAATAGTGAACTGGCACAGGTGGGTCTATTAGGCATCGAATAATAGCGTGTGAAAGGCTTACTGAGTTCTTTTTT
CCATCCAGGATGTGTCGGCAAAGGAGGAGGTACTAACGCGAAAGTTGAAGAATCAAGCGTCGAAGTAAGTGGAGCAGTGCCTTCAAGTGTTGTTTAGCGC
GTGAGTTGACCGGTTTCATGCTGATGTTTTTACTGTAGACAAGCGCAGCAGATTAAACATTTACTGCAGTTTTCAAGAGATTTGTACAAGGCAAGTGCTC
GTGAGGCATGCTTATCGCTGCAACTCGGCACACAGCAAGTTCGAGTGGATTTCACACAGAAATACCTGAAGCAAACCGAGGCTACCCTCCGGTAATCGGC
ATACGCTTGTTGGTGTGACACTGATGTATTTCAGAAGTGTTTTCTAACTCGTTTTAATTTTTTCTAGCGACCGCAAAGAGGCTTACAAGCTCGCAAAAGA
AAGCCTGCTGACTGAAGCACAGAAAGCGATGAAACTGAAGCacaaagcagaagaagaagctcccTGGGAAACCTACGAAGAGCGCTTTAACGAACTTCCA
GATGATTTGGATGAACTCCATGGCAAGATTGAAAATAACAAGGCAGCTCTGGAATGCTTCCGCGGAGATAGGACCATTCGTGAGCTTTACGAGCGAGTGT
GCGCCGAAATTCAAGATGATGAAAAAAATCTGGCTGCCCTGGAAAGTTTGGTcaacgatggagaagaccAAATCAGTGGGATTAAGGTGCGCTTTTGCTT
TTTGTGAGGTTCTAATAATTTGCTCTACTGCTGACGGATGTTCCGCTAATCCTGAAATTATAGACTGTGTGGCACGATAAACTCAAGGAGGTGGTGAATC
ACATCGATTCCTCCTTCAAGGAATTCTTCATGGACATCGGCTGTGTAGGCGAGATCGtcctcgacgacgaggatccGGTACGTGTGTTCGTCTTGTATTT
ATCTGGCGCGTAGCTGTTGGTAATGAATGATGTTTATTGAAAATGCTTAGGACGTCGCGAAATGGGGCATCCAGCGTCGTGCACAGTTCCGAAAGAATAC
GAAGCTTTCGACCATGACTGCTGAGGAGCAATCGGGAGGGGTGCGTCGTCCATTCGAGGGTTCTGCTTGTGTATTCATTCGGCTTGCTAACAGTGCATTT
CGTGCAGGAAAAATCGGTTGGTACAATTATGTACTTGATGGCCCTCCAGAGCCTCACGAAGTGCCCATTCCGAGTAGTGGATGAGATTAATCAAGGTATG
GACGTGTACAATGAGCGCAAGGTATTCCAGCGGATCACGAAGTCGTCATGTGGCAGTAAGCTGCCGCAGTATTTCCTCATCACACCGAAGCTCATCACAG
GGCTTACGTACCACCGCGACACGAAGGTCATGGTGATCTTGAACGGCCCGTACAACAACATTCAGCAGGAATTGTGGAACCCTGATCGCTTTATCGCTTG
CGGAAAACAAGGAAAGCGGAAGATGGGCGGCGCAGTCAATGGCTCTTCCAAGAAGCGCATTCGAGCGTAAGCAGATCGTGGAGGCTGTATATCTACTGAC
TACCGACAGCAGATGCTACACCAAAGGCGACAGCCCAAAGTGCTTGCTTCTTGCTGACGGAGAGCATTATAATTGTCATTCATTCATCCCTATGTTTCAT
TTCATCGTTCGAGTGTGAAGGTTCCCTGGTTGACTGACTATGCGCACAAGCAGGTTAATCGCACACGCTACTCTACATGAAGTTGAATGCCGACTGCCCG
CCACTGAGGCGTGCGCCATCAGCGGGGCCAGGAGGTgatgctgtggctgcggcAGCCATCCCTGCATTGCGTGGAGAGTTAGCAATCGCGAAGAGGTCCT
TTCCAAAATGGCTCAACACCTTGTTGCGCTCATCCTGCTCTGGCTGCTGGTaatattgctgctgtggtagctgctgctgaacatACGAAGGGTTGGATGA
CGTAGAGCTTCCCAGTGCGTCAAACCCATCCAGAAGCTACAGAGTGACGGCAATGCAAACTGCGTCAGAAACATTACCATGCATCATGCGCAAAGATATT
TGACGTACTGAAATTTCCTGCGGGGGAGCCACCGGCGCTGGCGGGGGCTGTGAACGGACTGGAGAACCAAGGAGATCTGCGGTGCCCTGCACACCTTGAT
CAACAGGGCCGGCAGACGATTCCAGGCTAAGCGATCCGAAGCCAAGGAGGTCCACGTCTTGTTTAGGGCTACCACGATGCGATCGCGTCGTGACCGAGCG
TTTTGTGCTTGGCTGGGGAGCCTGGTCGGCTTCGTCAGCAAAGCCAAGAGCGCGCAACACCTGCACCGCCTTGGACACTACGCTGGGTTTGGCATCCTTT
CGTAACTGCATAACAGTACACACAGGAAAGCGTTGTTAGCAACATCAGCAGTTAGTGCTGCGCAGTAGAAAGAAAATATTTCACGAACCTCTTCGACGAC
CTCGATGTTTTCCTCGAAAAATTCCTGGTACAGCTCAGCAACCGGCGACTCCAATAGCGCGAGCACTACGTGCAAACCTTTCAACCGAACTTGCCAAGTA
TCATCTTCCAGCTTGTCAAGTAGTATGTCACCGATAGTTTGAGCATCTAGTGTCTGCGCAAGGTCCACGAAGCGCTTTAGTCCATCAGCAGGTGGTGCCC
GTGATAGCCCCGCAGGCGCGCATAAGTTGTCAATCATTGTGCGTTCATAGTCCCTGTGAAGCAATAAGTCGCGTCAGTAACAATGCACTAAGATATGAAC
CTAGTCGGCTATATAGTCCCTACCTGCTCGTATCACCCCCGCCAGCTCCCTGTTGAGCATTTGGCTGGTAGTAGCCATGATCAATTACTTGTGGGCCGGC
ACGCAATTCGTCGTGGTCAGCTAGAGATGAAGCCATGGACTTGTCCATATTACGGCGGTCCCATTTCTCAAGTGCAGCCGAccccatcttcttcagtacT
TCCGCCTTCTTACCAAGAGCCGTCGTAGGTGCATCACTCAACGGCTGCCCGTTCACGGGAAGACCCATGCTACCAATGCGGTGGGTATTACCACTGAGCA
TACGGTTCGTGTTATCGATATAAGACGGAGTTCCACCTGAGTGACCACCGTATCCACCTTGCGCGCTGCCTCCCATGGCATTCGGGTTGTAGGAGTTTCC
GGAGCTTGCATTCGGGTTGTAGGAGTTTCCAGAGCTTGCATTCGGGTTGTAGGTATTTCCAGAACTCGCACCTCGAACAGCATTCGGGTTATACGTGCCG
CTGTTAAATCCTCCCAGTCCTGATGTCGCGCCGGTATTGCTAGCACCAAACCCGCCTGTCGGCTTTGGAAAGTTGAGAGAGTGACCCACCAACACCGTGG
GGCGGTTGTCTCTCCTAGTCGATGGATTATAGCGAGGCTCGTTGTCCATTGCAGGGTCCTTCTTTTGATAACCTGTGCTACTCCAgacaccagcgccagt
ggTCTTCGAGCCTACCCCGGAGTttgacgaggaggaccaCGAGCTAAACCCACTtgcctgttgctgctgcggtggcgcATTTTGACCGTACCCTCCCTGC
GGACCGTTCTGATTGTAACCGTATCCACCCGAGTTACCGCCATTCTGTCCATAGCTATTATCACCACCATATCCGCTGCTGTTTCCACCAGAGGGGCCAT
TGTAACCTCCACCAGAAGGTCCATTGTAGCCTCCACCGGAAGGCCCATTGTAGCCACCCGAGGGTCCATTGTAGCTGCCGCCCGCAGGACCGTTATTATA
CCCTCCAGATGGGTTATCCTGATACGGCGCTGGCCGGTTCGATGCCTGTGGCTGTCCCCATGATCCACCAACATTCGAGTGCTGCCGTTCAGGTTGGCCA
TTGCCACCATAAGGTCCATTCGAATTGCCATACGACGGTGGTGCATTGTCTCCCTGCGGAGCCTGCCAACTATTCGCACCACCCTGCGgaacctgttgct
gctgttgctgttgttgagtTGGCTCCTCGTTCCGACGCGAGAGGAACCCGTCATTCAAACACACCAAAGCTTCCTGGAAAAAACAATCACAACACCATGA
CGAAATGAGCTCTTGTTGCACCATCACATGATAAACCTCCTCCCTCTCTCCCTCTCTCCCTCCGACAACAAGCTCCCAACCTGCGACGCCACGCGAATAC
GGCGGTATTTTTCATCTCCATACACTGGATCCGGAGGCCCCGAAAACTCTACAAAACACAACAAATTAGCAATATTAATCCTTGCATCACGTTCACCCct
ctccaccgtcttcagACTCACGTAAATAGGCTGAAAGTTCCTGTTCCTCGTCCCTGATGGCGTCGGTGAATGCAGGGCCGCCCTCTCGGATGCAATACTG
CAGCAAAATAACAGCAACATAGGCCCACCACGTCATTACTACTGCATCCCTCTTTACGTTGCAGCTGCGTAACCCACCGAGATGATCTGCAACGCCTTGA
GCTTGACGTTTAAGTTGCTCTTGTTGAGTCGCCCCAGCATGTAGTCGGCGATCTTCTCCGCGTCGCGGTCGCTGGCCTTTGTCGAGTCTGCATCACAACA
AAATGTTGTTAGAAAACTGTGCCACCTCCTTCCCCGTTaagttgcagcagtagcGCACTGGCGATCTCCTCCATGAGGTAAACGGGCACGGGGCCGTCGT
GCAGACTCGTGGCCTCGGCCAGCGCGTGCCGGTTCatcgttctgctgctgcttcctgtgCTTCGGTTG