Description :
From Genome Similarity Track
Location :
Scaffold_2062:3762- 6159
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2062-snap-gene-0.2HECT ubiquitin ligase
Pytiw_DAOMBR242034maker-piw_contig_2062-fgenesh-gene-0.1HECT ubiquitin ligase

Sequence
2397 bases(100 bases per row)
TGTTCCTAAAAGGCCTCTATGAGGTGATCCCCCAAGCCACGCTCCTGCGATTCGACCCTGAGGAACTCGACTACGTGCTCTGCGGGTCGGACGAAGTCGA
CGTGGACGACTGGGAGCGCAGTACGCTGGTCACCGCCTCGCTCAAGGGCACGCGCAAGTACCTCGTCAGGTGGTTCTGGGAAATCGTGCGCGAGATGCCG
AACGAGTACCGTCAGCGACTTTTGCATTTCGCAACCGGTTCGTCTCGCGTGCCGATCGCAGGCTTCAGCGCGCTGACCAGCAACGACGGCCGCCTCTGTC
CGTTCACACTCAAACTGAACAAGTCAGTCACGAGCAAAGGCTACATATGGAGCCACGCGTGCTTTAACCGCCTGGATCTGCCCGTGCTCCGGTCGAAAGC
CCAATTCGCGACGAGTCTCTACGCGACGCTGCAGACCGAGCTGAACGGCTTCACGACCCAGTGAGACTCGAACAAGAGCGTATCACCTCCAAGCGAGTAC
TAGAGCAGTAATATTTAACCAAGATCAGGTTATCATTTCGCTCTTTTAACAGAAAGAAGACCACCAGGTGATGGTCTTCTTTCGTTTGCCCATCATTCTA
AAAATTCATTTTTTTTGCCTGTCTGGTGGTACAGTATTCCCTCACCGACCCGAACAGGGGCTGATAACCCTTCAAAACAGGATGACCTTTAATACTTGAT
ATTCCCACTCTATATTAATTGGCAAAAATTGCGTATAAAAATTTGTATCTTTACATTACCTCTATTATTTAATACTGATTTGGGGTGATGCGACCCTGTT
CGGGTCGGTGAGGGAACACTGTACTATCGTCACACACATTCATCATTCTTCTCAGCAGATACGAAGTACCTCGCTCGATGGTGGCGATGCTCGTGGTGCC
GCTCATCGGCGCGCTCGTGCTGCTCTGCGCGCTCGCGGTCTTCGTGCGCGTGTGCGATAAGCGCGGCGGCACGGGCGCCAACTTCGGCGGCGACCTGCGC
ACCGCGCTCCTGCAAAAGTGCGTCCGTTCTACGAGCGTGACTATTATTTTGAGGAGTTAATGATGAGTGTTTGGATGTATCTCTGTGTGTGAGCAGTGGT
GGCCGCGTGCTCAAGCACCGCCTCGAAGCCGCTTCAAGGTATGTGTGCGTGTTTGTGTATGTATGTCTATGTTGGAGTGACTGGGCTTATATTTTGTTGT
TATAATGCGTTTAGAGATGCCGAGGCGGGCTTCAACAAGTGCCAGTTCTGCGGCTTTGAGAACTTTAAGCGCACGCCGTTCTGCAACGTGTGCGGCGCCA
AGGTGCGCGAGTACGAGAGCCACTTGGACGCGCACACGGCGCAGCCGCACTGGTCCACGCTCTCGCTGCGGCAGCGGCGCGCGAGGTGCGTCTCACGGCC
TTCTCTATATATTCTGCTCATGTTGTATGGAGTGACTAATTCTTATATTATGTCTACTTATTGAGCGCAGGCTGCGCAAAGAGTGGCTCCGCAAGATCGA
TGTCGACGGCCGCGTGTACTGGTTCCGCTCGAGCCGAAGTAAGACGACGCGCACGACGACACGGCGTCTGCCAGGCTACGCGCTGCACTTTGTACGGAGT
CAGGAGGCCTTCGAGTCACCAGCAGACCTGATGACGACACCAGCCGACCAGACTCAGGTCCACGGACAGTCCAAGGTGACGATCGAGATCATCCCTCCCG
ACACGGAGCAGTCGTTGTCCACTGAAGCTCGAGAGATAGCCTTCGAAGCTCAAGTTGACATCCCGACGGCTCTCAGAAAAGAAGTTGTGGTCAATACACT
CGGCTTGGAGGTCACGCGCCAGCTACTTCAGCTCACTGAGTCCTCGACCTCAGAAGCCTCGCTCCCACCAGTGCAAACTTCCAGCACCAGTGACGAGAGC
ACAGTCCCAGCTCGCTCAAGCCGCGAGAAGTGGAGAGAGACGCTGCTCCCGTCGGTGCAGGCGTTTCCGACAAAGTACTCGCACTTTGTCTCATGCGCCA
CCGCGCTGCAGATCTACACGATGGAGCAGTATGTGATGCTCACGATCCGCCGCGAGCGCCTCCTGGACGACTCGATGGAGGCGCTCAGTGTCATCCCGCG
AGGCAGCATTCGCTCCGTGATGCGCATTGATTTCGCAGGTGCCCAGGGCGTGGACGCTGGCGGGCTGCACCGTGAATGGCTCATGATGCTGAACCAGGAG
CTCGCCGACCCAGCGAACGGCGTGCTCAAGTGCGTCGACATGGGCGAACAGATTTTTTACCTGAACCCGAACTCGCTGTACGACATTGGCGAAGATCACC
TCATGTACTATTACGCCACGGGGCGACTCATCGGCCGGTCGCTACTTGAAGGCCAGGTGCTCAACTTCCACCTGGCGCTGCCGCTGCTCAAGATCAT