Description :
From Genome Similarity Track
Location :
Scaffold_696:3762- 6151
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_696-fgenesh-gene-0.1Guanine deaminase
Pytve_DAOMBR484maker-pve_contig_696-fgenesh-gene-0.210 kDa chaperonin

Sequence
2389 bases(100 bases per row)
GCCTTTCGCAGTGGCGGCCGCAAGTCGATGGCGATGCCGCGGATCGTCGCCTACCGCGCCAACGTGGTGCATTCGCTCGGCCTCAACCGCCTGCAGGTGC
TGCAGCCGGGCATCGTCGGAGTTGAGGCCGGCACGGGCAAGATCGCGTTCGTGGAGGACGCGGCGACCACCACCGCTCAGTATGATGAGGTGAGCGACCT
GATACTACTGCCGTCTGCATGCTGGTTTGGATACTGACAACAAACTAATGACGCCATGTTAGCTGGTGGACTTTGGCGACAGACTGCTGATGCCGGGCTT
CGTAGACGGCCACGCGCACGCGCCGCAGTACTCGTTCCTCGGCGTGGGCATGCACCTGCCGCTGCTCGAGTGGCTCGAGACGTACACGTTCCCGTCCGAG
GCCAAGTTCCAGAGCGCCAAGTACGCCCAGGCCGTGTACGCCAAGGCCGTGCGGCGCCACCTGTTCAACGGCACGACCACGTGCTCGTACTTTGCCACGG
TGCACCTCGAGGCGTGCAAGGTGCTCGCGGACCTGATCGAGGCGACCGGCCAGCGCGGCTACGTGGGCAAGGTCAACATGGACCGCAACTGCTCCGTGCC
GGCGCTGCAGGAGGACACGCAGACGTCGCTGCAGCACACGCGCGAGTTCGTCGACTACGTGCTCAAGAAGAAGAGCCCGCTGCTGACGCCGGTCATCACG
CCGCGGTTCGTGCCGAGCACGTCGTCGCGTCTCATGAAGGGGCTCGCCACCATCTCGCGCGAGCACGAGCCGGCGCTGCCCGTGCAGTCGCACCTGTCCG
AGAACCGCGCCGAGGTCTCGTGGGTGCGCAGCATGCATCCCGAGAGCGACAGCTACGCGGCCGTGTACCGCGACCACGGACTGCTACACGACCGCGCGTA
CATGGCGCACTGCGTCTGGTGCTGCAAGCAGGAGCGCGCCATCCTGCACGAGACCAAGACGGCGGTCATCCACTGCCCCAACTCCAACTTCTCGCTCAGC
AGCGGCGTGCTCAACGTGCGCCGCCTGCTCAACCAAGGCATCAAGGTCGGGCTCGGCACGGACGTGTCGGGCGGCTACTCGACATCCATGCTGGACGCCA
TCCGCCAGGCGGTCATCGCCTCCAAGCTCGTGGCGATCGGCAGCGGCAGCGCCAGCGACGACGACGACGACGACGTCGACAGCGACGACAGCCTGAGCAA
GGAGAACACGGCGCCGCTGACCTTCGCGGAGGCCTTCCATCTTGCGACCGTCGGCAGCGCCGAGGCGCTCGGGCTCGGCGACACGGTCGGCAACTTCGCG
GTCGGCAAGGAGTTCGACGCGCTCGTGGTGGACCCGTTCGGCGAGGACAGCCCCATCGACCCGGCGCTGGACGACGCCGACGCCAAGGACGTGCTGCACA
CGTTCCAGAAGTTCCTCTTCCTCGGCGACGACCGCAACATCGAGACCATCTTCGTGCGCGGCCGCGTCGTCAAGCAGCCCAAGCGAAGTACTGCAAGCAA
TTAACCTCCAAAATTCTCAATGCGTCCAGTCAAATACAACCATATCATTTTGAGCATGACGTGGAGCCCGACGCGAACAGGAACGAGGTATCCGCACCAT
CAGCATTGACACGACATGGCCAGTCCGACCGATGTGCTGCACGGCTCGCTCTCGACTACGAAACAACAGAGTGACGGGAACTGCAGTGACCGATGGCGTC
GACGCTTACATACCTATATTTCTGAGCTTTTTGATTGTCGTCCGCCAGGCAAGGGGATGGTGTTCCCCACAAACTGGATGACTAGGCGCGCCGCAAAGGA
GAATGGGGTCTCCCCCTCGTGGCGTCGGCGCCGCTCTCTATCTACGCGAGCTTGCCCAGAATGTCCTCGTCGCGGAACAGGTGGAAGTCGGCGCCGTCGA
GCTTGACCACGCTGCCGCCGTACTCGGGGAGCAGCACCTTGTCGCCCACGGCGCTCTGCACGGGGATGAGCGTGCCGTCCGCCGTGCGCAGACCCGGGCC
GACAGCCACGACCTCGCCCTCGTTCTGCTTCTGCTGGTCGGCGTCCGGAAGGTAAATGCCGCTAGCCGTCTGTTCGCACCGGCAATAACGACACTGTCAG
CTTGAACCTGCGCGAGCCCGTCATAGATCAACGCGCCGCACCTTGGCGACGGCCTCGATGCGCTTCACCAGCACGCGGTTGCCGAACGGGATCAACTTGC
GGAGGCTCTGCGCGGGACCAGCACGGCACGCGAACAGCTCGTTAGGCACTGCGACCACACAAGACGGCGGGGCCCGCAAGGACGCGAGGGACGCGAGAGA
TTGCGCACCATGATGCTCGGAGAGAATGCGCTGACAGGCTGCGGCCAAATTGCGAATTGCGCGAGCGGAGCAACCACCACCGAACGTGC