Description :
From Genome Similarity Track
Location :
Scaffold_1290:3761- 5775
Transcript NameFunction/comments
Phyag_g10181hypothetical protein PHYSODRAFT_548135

Sequence
2014 bases(100 bases per row)
CAAAATCTTGTACTTTGGCGTGCACAGAGAAATTAGATGCCGCTTCAGGTCCTTCACGTCGATACCCGTACGCTCCATAAGCTCCTTAAAGCGCCACTCA
GGGCGCACGTTGAACAGCATCAAAATGACGGCTTGATAAGTCGATACGTTCAGCTCATGGCGACGCTTACCGCCCTCTATGTCCGCCGAAAACGTGGCGC
GAATATCAACTGTACCCATATTTGCCATCCACGCCAATTTACGACCATTGTGTCGTGCGTAATAGAATGACTCAAACGCCTGTGTCAACTGGACAAGTTC
CAATGGCAGAGCGCACATAGGAACCATCTCTGTGGGCCAGAAGCCGCTTGTAAGCACGTGCACCGACAACGGCATCGGTGCGACTGACACATCGATACCA
AAACCGGTGCCTCTGGTGTCGTAACCCGACTTCCGATAAAGCTCCATGAGGTCCTTCGAAATACCCATATCCTTGAACATACCTTCCAACTTGGAAGTGA
ATTGGTAGCCACATTCTGCCTTTAGCTTCGAGATTACAAGACGTTCCGCCTCGTCCGATGTGCCGCGGCTGTTAAGAAGACGTTTGGCGAGCAATACCTT
GTAGAACTCCTCGAACACGTCTTTGTCCTGCAAATAACGGAACAGTGCAATGACTTGCGTTACGCGGGTGTCCATTTCCTCTTCAAAGCGATTTTTTGAC
CGCAGCAATTCGTCCAGGTAGTGCGCTAGGTATCCAGCACACACGGTGTTGGTGTTCATAAAGCCCTCAAAGCCCTGTTTAATGGATTTGTGGAACTGCG
GGTCGTCAAAAAAGCAATCCGACAGGAACCCCACAAACTTTTCTCTCAAAGCCAGAAGTTTCTCCACAAACTGCGACGCATCCAACGCTGTCTCCGGGTT
AATCTGTGTCTTCACGATCTCCTCTCCTTGTGCCTTGATGTACTGGAACACACTGTCACTGATGTCAGGTAGTGTGCTCGGTACACGTCGGAAAAGCGAG
TACATCCTGCGTAAAGCCTGCGTTTTACCGTCACGGAACAATGCAACACAGCCGGAATGCTCCATATCCACGAGTGCCTTCGCCTGGTTCTTAATCAATT
GCGTCTCCACAatcgtcttcaacttgtgtTCCGTTGACGGGTTCAGATAATGCAgaactcgagctccttcttcattAAGACGTTGCTCGGCCTTCTCCAA
GTACTCAGGAGACGTCGCCACGTCCAACATCGCCTGTGCTTCTGCCCGGTAAAAGTCCAGCGTCGTGTCGAGGAAAAACTTCTCAAAGTCGTTCTCGTAC
ACCGTGTTCGAGTGCACCCCTAAATCCACGAGCATCCGAAGTACACTCTTAACAAGGTCTCTGTCAATAAGCTCCCCATGTCGCTCCCTCTCAAtactca
gcagcagtcgagcGCGCAGTCGATCGCGTACACTGTCATGACGCACAATGACGTCCCGGAAGATGTAGAGGCCGTTGTCGTACACCggcagcttgcgctt
ctgcgtGACGTACGTGCGGTCCATGTACATGAGGATGTCGCGCACCATCGTCATGACGATCTGGTGGTCTGTCCATTGGTCGTTGAGTgctacgagcagc
agttcgtccgAGACGGCGGCCACTTGCTGCGCCACCCCCTGGAGGTGCTCGGTGATGACGCTCACCACGCCATTGTACAGAAGGTCCCCGTGTTTGTGCA
GCACAAGGTTGTACGAGTTACGGtacagctcctcgaacgaCAACAGACTCGCGTTGTGCGAGAAgatctcgtcgatggccgtgcgcagcgacgaccagaT
CTCCTGCGCGCGCGTCTGGTCCATGCCCATGTTCTGGCGGTACGGCTTgatcaccagcttcttcatggcgggcggcagacgacgaagagagagagagagg
aagAGAGAGAGTCTGATACGATGAGGAAGGATTCGATCTGTCGGCAATAAAATAATATGTTGTGAAGTAAATCTGTATCTGATTGGTGGATAATTCTGCC
TAATCAGATCGTTG