Description :
From Genome Similarity Track
Location :
Scaffold_2033:3760- 5481
Transcript NameFunction/comments
Phyta_totarag14027hypothetical protein PHYSODRAFT_311514

Sequence
1721 bases(100 bases per row)
CAATCGACTCTTTATAGATACGGTTCCTAAAGTGCGCTATAGTGGTGATGTCAGAGATAGAGTCTCATGCGGTTGGAAGTTATTTTCTCTTCGTCTATAG
TATATTCTCTTTTTAACGCAATTTCCACGCGATATGATAAGTTCGACAACTCCAGCCGGTGATGAATGAAAGTCACCATTTTCTTGACTTGATATCATTT
CAGGCACATTTTAAAAATTCTGCCGTTATTAATACTGATCCATCGATAACTATGTAAATAGAAGAACATGGATATTATTTTACGGTAAACTAAAACTTTT
ACATAATATGTTGTGCCGAGATCTTGCAGCGGCTATGGCTCAGCCATACGACCAGCAACTCGTGATGCCCCAAAGGGAGGTCGCCCAAGATGAGTAGCAG
AGAAGTATGCGTACTTCTCCCCCCCCCTCCCGCCCCCACTTATCACGTGTCATTCACAATTAACATCGTCCCAGGCAAGCCAACCAAGAACCTCAATGCA
CGCCAGCTATCTTTGTCCACCCAACAGTCAGTGGCTGAGTGACGCTGTGATCGGCGAAGTTGTGGTGCGAGCCGGAAAACTACCACGTTACAGTGCAGCA
AGTCGATCTACCGTCGCCCAGATAAGTCGTCCAGAAAAACCCCGTCACCAAAATGTTGAGTATTCATTCCGCAAGGTGCAGTGACCGACCCTGTTAGAGG
ACAGGATGTTGATCCGAGCACCTTTCACACCAAGACGCCAACCGCTCCTACAAGTCTGCGTCATGAATCGCTCCCCGTCCCATCTCAAATCACGAAGCTG
CCGGTAAACAAGGGGGAGATGGATTTAACAAGCCGTCACTCCAGCAACAAACCACGGAAGCTCGTCGAAAGGATATCTGTACTCCATGGGCTGAGCCATC
GACAACGTCGTCAAGCGACCCAGCAGTTGTACAGAAAGAGATTGCGCGGAAAAGAAGTTGACCTCGAGATGAACGTCGTCCGGCTGCGCGAGGAGGTCCG
ACAACTGTGAAGCGAATTTCGACTCCTCCACGATATCGGATGATTCCAAGTCCGTGGAGTGTAGCCATCGAGTACTTTCATCTCGTTCGCAACGGTTTCA
ATCCACCTGTGTCGGGACCGGGACGAGAACGTGTCATGGCAACGGTGTTGTATTCAACAGAAATCAACGCGTTGAGTGTCTTCTTGCACGCTGTGACGGC
GCCGGACGTGGCGTTCAACAGGGGACGAGGACCGAATGCAATTCTAGAATTTTGGAGGTTGTCTTCGTTTCATCACAAAACATTGGGATTCCGACTCGTT
CGGTTAGAGCGTGGCGCGAATGGTTTGGTGGTCGCTTTTGCTGACGgatccaccaccaccacgaaaaAGATGCTGCGCACCGCGCTTCCTCACCTCGTTC
GCGAGGCCAAATGGTCGGCGATTGCTACGAAACTTGTTGGTCTGCGCCTTGTGATTCCCAGCACTACAACCTTCGGATGGGACAATGAGGTGGCTCGTAT
TGTTAGTGTACACTACGAGACAGACATGCTGACACcactgctcaagctgctcgacaACTTGGAAAATGTGTCCATCGTTCTCAACAGCGCAATCGACGTC
CAGTATTGGAGTAGACTAGATCAATAATCAGTCAACGGGTAAGGAGATGTGGAGAGCGCGACATGGGCCAAGCCAACCAGCATTTACACATTTGAGACTA
AGAGACCCAGTCTAAGTATAG