Description :
From Genome Similarity Track
Location :
Scaffold_9:375959- 378346
Transcript NameFunction/comments
Physo_290093secreted RxLR effector peptide protein, putative

Sequence
2387 bases(100 bases per row)
GAATCTCGTGAATGCGTACTTACAAAGCGATTAATGCACCCCCTAGACTATCAAAGGCTGAATGAAGAAAGGAACTTTGTGGACGAATTCTTTGAGGTTC
CAAGGTCTGATACTGTAGTACTCGTACTTCGTAAGACATTTAGCGGCTGAAATGATGAGCAGCCTGCTCATCAATAGCCCGCAGCTCACCACGTTGGTTC
AGTATGCGCACGATTTCAACGAGCAGCACCTCAAAAAGCAAATCTCGATCTACCGAACCTTGAAAAGACACGATTGAGAAAGTGAGGGAGGCTCAGCACA
ACTGCAGCAGCGAAAGCTTTTACTACTAGTATACCTAGCGGAGCGCTACTAAGTACTACTCGTTCTACTTGAATGGTACTGCGAGAATGAGCTCGTTGGC
TGTATGCAAACCAGTCTAGTGAAGCACAGGGTAAATGTACGTGTCGTATGCGTCCTTGAAAGAGCAGCTCTCATCATCGCGGGACCAGCACACGTGCGTC
ACGTTATCGGCAGTCACCAAGAACAGGCCGCCGCGTTCGTCAAGCGTGCGAAGGCCAAACGTGTCCGACGTGTACTCGAGCGTGTCCTTCATGTCGACGA
CCGAGAGGCTGCTGAAGTTCGTCTCGATCTCGTTCACCGACTTGACTTCCGAGTATCGCCCGAAGATCGACGACTGCCACGGCGTAATGGTTCCATCCTC
GGGTGAGATGAAGAAGTAGGCGGACTCGAGCTTCAAGAAGTTGGTCTTGCGACGATGCTGGTCGTAGACGCACTGGCCATTTCCAGGCAGACACGGGTTC
ACGTTGTTCAGGACGGGCAGGAAGATGTTGGAGGATGCCCAGCAACCGAACTGTGGGGAGCGCTGCAGATTGAAGTACGAGTATTGATACTGCACCTCCG
GGTTCTCGAGCGTGAACTGGACAATGTCGCGCTCAAGTTTCCCGTAGACATCCTCGGACGAGTACTTGCTGAAGTTGTAGACCTCGGCCGGAACGATGAA
GTTCAGGTAACTGGGTCCTGAAGCCGCGAGTGCGTCCGCATCGTCGGGTCCGTTGAAGATGCCATTCTGAACGCCGGCCAAGCTGATGTAGCGTTTCACT
TGGTGGTCGTCCATTTCCTCGATCACAGCTCGTGAGATGGCGCCGCCCTGTGAGTGAGTGATGAAGATGTAGCCATCGTCGAACACGGAGTTGTTGGCCA
CCGTCTCCCGCACGGCGGCGACAGCGAGCGGGACTTGCTTCACGAGAGACTCGAACGAGCAGGAGGAGTCGCAGAAGGAGAGCGACACAACCGTGCGGCC
TTCAGCAGTGAGATTCGCCACGTAGTTGTCTCCAGCGGTGTAGTCGTCGGAGAGGCCGTGGAAGAAGAAGACAGGCAGCTTGACACATCGGTGGCGGCGA
CAGCGCTTTGGACAGTAGCGGCTGCTAGTCCGAGGAGAGGCGCGCAGAGCTTCATCGATGGCGTCGGTGGGGTGCTCGGTGTTGATTCACGGTGCGGATA
ATGAGCTCGAGGTCATTGCAACAACGCTGGTTGGGTGGATACTGTAGAACACTTGAAGGTTCAAGGACCAACCCTTCCCGGTGCACGAACTCCATGATGA
CACTCCGTCGTCTTTCTCACTCGGCTAAATTGGCGAGTATGATAGGAACGTTGGAGCGGATCTCTCAGCTGACGCGACCCCACTTCAAGAGCCAGTATTG
CCTGCTTCCCGTAATTCCAGCACAAGGCAGATTCTTCAACCATGTATCTCGTCACCACAGAAAACCATATGAACACACACAAATAAAGCCTACGAGAACC
ACTAATCTTGCACCAGGTAGGATACCTTACCCAGAGACTGCCCAGACAGCAAGCAAATCTGTGACGTGTGGCCAACATGTATCCATGTACCGTAAAATCG
GTACGTTTTTGACTCGTACTTAGTCCCGCTATGAGCTTCATCGCCACGCACGTCGCCTCTCGACCTCAGATCTGCTGGCGTTAGTGTCATATTGCTGCCC
ATGCGTCCGTCGCTCGTGCTGCGCCGCGCGCCTCGCGCCGCCAGCCTCCTGCGCAGTCTGTCGACGGCCTCTTCGTCCTCCGGCGCTGCGTCCTCAAGCG
CCGGCTCCACGACGCACTTCGGCTTCCAGCAGGTGCCTGAGGAGGACAAGGAGCGGATGGTGGCGTCCGTCTTCCACAATGTGGCCGAGCGGTAGGCATA
TGCTACAGAATCTCTAATTTTATATCGATATGACCGAATACGTTTCTCATATCTTGTTATGACGACTTGCTAGATATGACGTGATGAACGACTTTATGAG
CGGCGGCATGCACCGCGTCTGGAAGGACTCGTTCGTGGACACGCTGCACCCCGTGGGACCTCTCAAGTGCCTGGATGTTGCTGGAGG