Description :
From Genome Similarity Track
Location :
Scaffold_19:375922- 377296
Transcript NameFunction/comments
Phypa_INRA-310PPTG_10287hypothetical protein

Sequence
1374 bases(100 bases per row)
TGATCGAGTGGACGCTTTCGGTGCGGCTTATCCACCAAGATCTCGGTGTTCACTGAAGTTCAGGCGATTTCGATGTTGACGGGCAGGGCAATGGGACGAC
GTCGTTTGTCCGCCCACTTTCATCGATCATCGGAGCTCGTCATCACATATTTTCCGCAGCAATTCGAGGACGACGAGGATATTTGCTGCTGGAAATGTAT
CTCCGGTGGAATGCTTCCATTTGGTATTACATGTGCATGTATGCGCAATAAGAAGTTGGAATGCAGCCACATTACATAACATGTAAGTGTAAAAACTTTA
CTGTACCTGAGAGTCATGGATTTGCTGCTGCTGGGTTGTATCGCAGCCTTGAACAGTAGAAACAGTGCAGTCATGAACACGCTCGCGTTGCAGTTTGTAT
CTCTTCGATTGACGAGATATGTACCACACCGAGTCCGACAAAGTGGTGGATTGATAACGTTCGGCAACAACATGCCACCGTTAAAGACTGAAGAAACAAG
CAGGCGGGGATCCCTTTAACGGTGGACTGAGAGAAGATTCTCCAAAAATGTTGAAGGCATGACAGCAATTTCTTATTCGTGCATTAGTAGCATTGGTCAG
CTTAGGGTAAGATCTCATTCTCATGTTGAGGACTACTGTGTAGTAATTTACGCGATTGTTCACGTATTAAAATCTGATCGAAATTATGGAAAGTTGAATT
GTTTGATGAAGATGTCGAAGTCGAAGTCGTGCCTGGATACGACTTCGATGAACTCATCCTCGCCGATGCTTCCGTTCTCCCTTTGGATGACGGAATGTTG
TCGTCACACACACTTGAGCTGAGAGCTTTAGTTTTTTATTTTAAAGTTCTTTAGAAAGCTCCTTACATTTTTTTTCATATACTAAGCTTACGGAATTCCA
TGGCGTCCGAGTAATTTGACAATAATCAACGCGACGAATTTCGTACGTGCTGCTTGCAGGGAGCAATGTCTGGCGCCACCAGCATAGGACGAACATCAAG
TTAGATCGGCGAGGTCATGTGGTTTTAGTTTGTTCGTCCTGAACATGCCGATGAATTCCATGGCCAGGAGCGCGTGTTGTGACCCGGAAGCAAAGTTGGT
CGTATTTCGTGTGTAGAAAAAAATCTTCTAAAAGGATAATCATGGGAAAGTCGCAATTCAAGGATCTCCACAGCACGCAAGTATTCCGGTAAGTTATGCT
TTTCGTGAAAGTGGATCGCCTACCGCGTCAACGTCTAGATTATTGTCGTCTACGTTCAGCGTAGTGCATCAAACGTGGTTTGAGTCAAGCTTTTCGAATA
GCGAGGGAGGGTAAAATTCAACATCATCCTCGTCGTGACAAAACGAGGACGATGATCTAAACGTCGTGGAGTTA