Description :
From Genome Similarity Track
Location :
Scaffold_1192:3759- 5896
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_1192-snap-gene-0.1Conserved gene of unknown function

Sequence
2137 bases(100 bases per row)
TTCGCACACGGGCCAAGATGCTGTCGCCGCTCCCATCGAACCGGGCTTATGCGTCTCGCTCACGAACCATTTTCAAGTACAAGTTCGAGTTTGTACTGAC
TGGCTTTGTCAAAGAGGGTGATGCGAGCTTGTCTGAGCTGATCGAGGAGCATGGTGGAAAAGTGATGGATCGATACCAAGACGTTCTGTGTCGGGGGAAT
GGCAAGGCAGTAGTTATTGCGACCCCTGTCTCGTGGCGGAAGCGGAAGTTTATGCAAGCGATCAGCTGTGGCATCCCTGTGATCCATCCAGATTGGATCC
AAAGTTGCATTAAGGAAGCGTGCGTGGTTCCGTTTGATGGCTATTTCGTTCCGTCTGGATATTCCGTTACCACTCGAAAGTTCGAGTGCTTAGGCGTGAA
GGAGGTGAGGTTGCTTGTTGGCATGGTCTCGTATATGGTGTGTGGACGTGGTGTTAACGTGTTCTGTATCATGATTCTTTTCGACACTCAGTTGAACATC
TTTAATGGATACTCGTTCGGAATCGCCTGCGATGTCGACCACGCTGCGAAGAATGGCGTGAGAGAAATGGCCAGCATAATGACATTCATCCTAAAAGCCT
GCGGAGCATATGCTGTCCACGAGGTGAGAAGTGACTCCATCGAGTACTGCCGTGTAAATCACTGACGTTGGATCTGTCGTGTTGAACAGAACCTGACAAT
CTCCAAAGACACGGAAGTTGACGTTGTTTTGTGCGATGAATTCACAAAGGTATGCACTTTTGCGCCAATCAACGTGTTCGGTGTAGGGTATCTATCACTC
ATGTTAACCTGAGTAGGTGTGCAAGTTTTACTCGCGAAAGCGAAAGATCCCCGCCAAGAACTTCTCGTGGGTGACCGAGTGTGTCATTCTTCAGGTGAGC
ATGTCCGTTCGTGGTGACAGTCGAGATCAGCGCTCACAGCGTTTGGTCATTAGACACTGCTGGAACCCGAGGAATCCGATTTCCAGCCGCAACATGTAGA
TCAAGACACGGTTCTGTCCGCAACCGCTGTCATTGGGGATCGTGAACAGTACGTTCATATTTGTTATATCGTGACAGTGTCTCCTGTTTAACAGCCATGG
TTATTGGTTGCCAGATCGACATTGAAGCTCCACACAGGCGAATTGATCCTCGCGGATCTCTCTGGTAATGGCATCGACCACTACTTGCTGTTCCACGTGT
GCGAGATTGTGGACATTTTCGTGAAAAGGAGAAGTCACCAAGACGGCGACGCGAAACGGCGACGAGTGGAAGAGCCACCGACGGTGATGCTACGGGTCGG
TGTGCTGAAACGGTACGAGCATCATTCTCACGACGGTTGTGAATTCGTTTGTTGACCTTAACGATCATGATTTCGCTAGATCTCCGTACTCTGCTGGGCT
GTCCAAGACCCATTCTCGCGTGCTTGAAATCCCATCCACCCAAGTTAAACGGCGAGTGGTTGCAGTCTCGAAGGACGATTTCGACAAATTCAAGTATCGC
GACGAGAGTGTTTTCTTCTTTGAGGAAGAAACAAGCGAAGAACAGCAGTAAACCGCGTAGTTTTAGGCAGACCTCGAGCCAATATACGCTGACCTAAATG
TCTCCAGAGGTGGCTCTACTACAGGGGGGAATTTGGCGCGTCGTGCTCAGTTGTCGTTTTCGTCGAGGCGTACACGATCCGGGATAAACAGATGAAGCCA
TGGCTAAATATGATCACATCGAGACCGTCAATGCAGCACACAATAGAACGGATCGTTGCGCAATCTAGCAGCGTACTCGAATCGCAGGGTCGACGCCTGG
GTCTGAAAACATTGTCTGGCAAATGGCAAGTGTATGAATCTCGCTTCGATCAATTTTGCGATTTGGACGGACAGGACGGATCTAACCTGCCACGAGACGA
TCCCCAGGTGTGTGATTATCATGCGGTAGTAGTTGCTGAAGGATTCAGCGAGGAAGCTCCATTGCCCTTGCAGGTTTCGAAACCAAATCTCGGATCCAGC
TTCGCACCGATCAACCACAACCAAAATGCAAGTGAGCACGCAGTCAACGACAAGAACACGGAGTGGTGAGTTGAACCACCTTCAAAGCAGACTAGAACAA
CATCACCGAATGTCGGCGAAGCCTCAAGAGTAAAGCC