Description :
From Genome Similarity Track
Location :
Scaffold_467:3758- 25948
Transcript NameFunction/comments
g11764.t1hypothetical protein
g11765.t1hypothetical protein
g11766.t1XP_009530061.1 hypothetical protein PHYSODRAFT_334506 [Phytophthora sojae
g11767.t1hypothetical protein
g11768.t1hypothetical protein
g11769.t1hypothetical protein

Sequence
22190 bases(100 bases per row)
TCGACACACAATTGGTCGAAAGACACTCCGCCGTTAGGCGTAGAGGTAAAGAAGACGCGTCGGCTCCCAGAGCCGACGCTGCAAGCAGTGCGGACGGTTG
CAAACGTCCCGCACCGGAAATGCTTGCGAGCTAGCGTGCAGCCGGGCTGCACGACGAAGCGGTGCGCGATCAAGCCGGGCTTGAACGCGTGCGCCGGCGG
GTAGAACCCGCCGGCGAATACAAGGAACAACTGTCCACGGCCGGGCCTGGACAAGAAGAAACTCGCGAAGCCGGGCTCCGCACGAGAAGTGAACGGCGCA
AGCGAGAAAAGCTGCGCAAGTCTCGGTCAGGGACCGAGACGCTACAAGCAGTGTCTACCGGGCAGACACAGGAGTTGGAGACGACCGTCGAGACATTGAA
TGTCTTGACGCGTACGAGTATTGGTCTCCAATACAAGAAGATGAGGCTGAATAATCCTCCGACGTTAGCATCGGAGTTGATGTCGCTCCCAGTCACAAGC
TGGAAGCGTTTCGCTCGCGAACTGCACGATGGACGCATCGAGCAGATCTGCATCCTCTCGGACGTCGAGAGGATGAAGTGTGAAGCAGAAGAGCTGAATC
AGCTCATCTCTGAGGGCGCGGACGCCCTCAGCGCGAAGTCGAAGAAGGAACGCTTCGACGACCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAA
GGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGACATTCCTGCGGAGTTACCGCAGGACAAAGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAACG
AAGTACTGCGTCACGCGACAGTGGCCACTGCCGCGTGAGCAAGTCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAAAGCCGGACAAGTGCGGGAAT
CGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAACGACAGGGCGGGTGGCGCATCGTTCATGCGTATAACAAGCTGAACGATGCGATGGTACC
GGCGCAGACGCCGATACCTCGAAAAGATGTGATCATCGATTCGATGACCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATC
CTCATGCGTGAGAGTGATATCCCTCTCACGGCGGCAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTCGTGATGCCGCAGGGGCTGAAGAACGCCCCAG
CGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCCCGGTGCGCGACTTCGCACCGAGCTATTTCGACGACGTGTTCATTCACAGCCGGGCTGTGAATGG
GAAATCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGCACAAGCTCTACGCGAAGCTGAAGAAGTGTATCTTCGGG
GCGACCGAGATACCCGTACTTGGGTGTCTCGTGGGGAAGAACGGCGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTCAA
ACGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTACTTGTGCAAGTACGTGAGCAACTACGCGGGCAAGATTCGCCCGCTGTCGCAGCTCTTAAA
GAAAGAGGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGCCTTCGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAA
GATCGCCCATTCCACGTGGTGTGCGATGCATCCGATTTCGCGATCGGATGCGCACTGATGCAACTCGATCACGAAGGTCGTGATCGTGTGGTTTACTACC
AATCGCGTCAGCTGAAGCCAGCTGAGCGCAATTACCCGGTACATGACAAGGAACTCCTTGCCATGAAGTATGCACTCGCAAAGTTTCGAGTGTATCTACT
TGGGAGTAGACCATTCGTGGTCTACACCGACCACGCATCGTTGCGTACGGCGATCAAGTCGCCGCACATATCACAAAGAATGGCACGGTGGCTGTCATTC
TTTGCTGAATACAACTTCCAGGTTGAGTACAAACCTGGAAGGTTGAATGTCGTGGCCGACGCGCTTTCGCGTCGACCAGATTATGCGGTGCAAGAGGCCG
ACGCCAACGCAGTTGGCGTCGTCAGGACGACTACACCCTCGTCGTCCTTGCTGGACGAAGTGAAGGCCGCATACGCACATGATGCGGATGCGAAGCAATT
GTTGGAGTACTACTCCACACCTTCTGACAAGTCTCGTCAGAAGCTGGCCAAACACCTTCGTGCCCGTGTACACCGTTATCGTGTACACAACGGTCTGCTG
CTTTACAGCGCAGTCGACGACAACGCAGATCGCATTGTCGTGCCGGATGATCATGAGCTGAAGCTCAAGATCACGTACGAGTACCACGATGCCCCGACAT
CGGGACATCCTGGCCGTGAGAAGACATATTTGCTTCTCACGCGTGACTTCTATTGGAGTCACCAGTACAAGTGGGTACGCAAGTACGTTCGTGCTTGCGA
GGTATGCCAGCGCGTGAAGCCTGCGCCCAACTCGCAGGCTCCGCTTCAATCACTACCGACTCCGTCGGAGTGCTGGCAGTCCATTTCAATGGACTTTGTT
TTTGGTCTTCCGCAAGACAACAAGCGGAGGACTGGTATTGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTGCATCTTGCTGCAGTACCAGCCGAGGTGA
CAGCCAAACAGACGGCATGTCTGTTTGTTGACCTGGTGTTTAGACACCATGGTATGCCACTCGACATCGTGTCGGATCGGGATCCGCGCTTTACAGCGCG
ATTCTGGCAAGAAGTGTTTACACTTCTTGGGACGCAGTTGTCCATGTCGACTGCGGATCACCCGCAGACCGACGGACAAACAGAGCGTGTCAACCGCGTG
CTGGTTGACACCATGAAGAGCTACGCGCACTCGTTCCATCAATGGAGCGACTGCTTGCCGATGGCGGAGTTCGCCATCAACAACTCGGTGCATGTCTCGA
CAGGACACACACCGTTCTACGTGAATGCCATGAGGCACCCACGCGTACCGAGCGTACTCGGTGCGGTAGCTCCTTCCTTAAGTGGGGGAGGATATCCGGT
TAATTCAAAACAACCGGATAAGCACGCTGATACAAGCAATGTATCAGCTGTGACGACTCGCGCACGTACTGCGCGCAGTCATGGCGACAACAAGACAGTG
TCTACGACGGGCGTAGACACTTTAAACGACAACGAACATCACGCGCAGGCCGGGCCTGCTGCGAACAAGGAGCACGAACTGAACCAGGGGTTCAGCTCGG
ATGCAATGGACTTTGTCCAGCGTCGACAAGCCGTAATTCGGTTTGTCCAAGATGCAATAGCAGCTTCTGTCGATCGACAGAAGCTGAATGCCGATAACAC
CGGCAGGGGAAACACAAATGAATTCAAAGTTGGTTCATTAGTTCTGTTAGCTACGCAGAACCTAGCTAAACATGCAGTTTCCGATTTCGGAGCAAGCAAG
CTTGCTCCGCGCTTCATTGGGCCATTCACCGTGTTGGCGAAGCATGGCAACGCGTACACACTGGACATACCGTCCAGCATGCGCTTGCACCCAACGTTTT
ACGTTGGGCGACTAAGCCGTACGTGCAGCACGAGTCACCTACGTCTGGTGACTCGCCAAAGCGCCCTCGAGCGCGGCGACGCGCTTCAAGGCGCCGGAGA
GCCTCGTCCCGACCTCGACTTTTACGTTCGAGGTCGTCTGCGCAACCTCCGCGAGCTGAGCCTTTAACAAGCTCAGCTCCTGACGCAGAGCAGCGAACTG
CGACGCTTGGAGACGCTCAACAGCCTCCAAGCGAGACTCAAAGTTTGGTTGACCAAACCCGGGGCGTCTTCCCGCCCCCCCCACCCCCGTTGCGAGACGC
ACGCGGGGCAACTCGCTGGATCGTCCAGCGAATTGTTGGTCATCGGAACCAGACCCGAGGTCCGGTTCATTTTCGTATTCGTTGGAGAGGATTTCCTCCC
CAACACGATACGTGGGAATCACGGAATGTCCTGATGGAGGACATTCCGGAAATGGTGACGGCGTACGAAGGCCGCCACCGCCACCTCCGCCGAAGGGCGT
AAAACTTGGGCGAGCGCTGTAGTCGCCTACAGCACTCGGATAAGTGCTGCGATTATCCGCAGCACTAGAAGACGCCTGCGCCTGAAAACTGGCGCGCAGG
TCTTGAGGTCGTCAGGTACACACATGGACGTGTACCCGTTGACGTCCCGCTCGGTGATGCGTACTGCTCCAGGGTAGCAGTACTCACAAGCAGTGTCGTA
AGGCACTGCGCAAGGAAGTCCGATACCGATTGCACCATGGTGCAGTCGTTCAAGCTTACCACGCTTCGAGAACTTCTCGTAGCGCTCCCGCGCCTGGCTA
ATCCGATCGCGATAGCCAGCGGGGTTCTTGTTGAAGTTTTCAACAAAGGCACTCCAACTCTGACAAAATGCCTGCCACTCGGGCACTTTGCTTCTGCGAG
AAGTCTTCTTGCTCGCAAACCATCGGAGCTCATGGAAGAGCCCAATGTAGTAGTCGCGCCTTTGATTCGTTAACGGATCAAAGTGTACTCGCTTCGCGAC
GTCATCGTCAACGATGGCGTTGCACGAATACAGCGCGTATAGATTCGGTGGTGCGGTCGCACCGAATCGGCTGCCGATCTCAGACTGAGACGGCATCCAC
GGCTCGCGCACTGGCTCAGTGTGCGAGGCCACAACAACAGCGGATGGAGCAGAGTCATCTCCATCCCGCGGAGTCGATAAGGCTCCAGCGGCAGCGAGCG
GTGTTCCACTGCCGCTGCGCGAACGCTTCGAGCTCGAAGCGTTCGGGTCGTCCTCGCGTGGACGACGTAGACCCACATTGGGGTCAGTGTGGCCCGGAGA
CAAGGTGTCCTTGTCTCCTTCGAGTTCCCCCTCCTCGACTTCACTTCCGTAGTCGAGGGGAACTCCCTCTCCACCCGGAGAGTAGATACCCACTCCGGTT
TCGACAGCAATGATCTTGCCTGTCTTGTTTCGGATGGCATGTTTCTCGTGCCATCTCGAGTGGTATCCAGCAACAGAGAGGCGACTCTCTGTTGCCGCGC
TTGTCGGCAATCGCCGTCGAGGCGATGCCAGTAGCGGTCGTGGCTGAGGCAGCGGCCTTCGTCGCCTTGGAGGCGACGACAGCACTTGCTGTTGCCGAAG
CGGCCGGCGTCTTGGACGAAGACGTCGTTGGCGTGCTCATTGGGAATGAGCACGTGTTCTCCCGAAGAAAATACGGATTGACGTGTCGAGACCGGCACGT
CAAATCCTAACGGGGGGATGGTGTAGCGGGGCTACACATTCGGTTCACCTCCCACCTTAGTGCAACAAGCACTAAGGCATACATTCAGGTGACCACCACA
GGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAGTAACACCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCAGCCATCC
AATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGCAAACCCAGTTAACCTTCAATTCAGTTCTCATTTACCACCAAAGCTTCCGTTTGGTTCATT
TATCTAGGTTTCAGTATACTTGCGGATGCAAGTATACTAAACTTAAGTAAACTACTCCTACGCTTCCTCCTACACGTGCGCACACGTGTAAGCTTAAGTA
GTGGGTCTAAGCAGACCCATTACAGGAAGGAAGGTGAAAACCTTCACTTCTGGATCCGAGAAGTTGAGATCGCCATGAGGGCGGGTCTCATCTCGGATCA
GGGACTTCGCGTTGCGTTCGCGTTGTCCAACCTAAGGGGTCGTGCCAAGAATTGGGCGTACACGCTGGAGACGACGTCTCCTGGATGCTTTGCATCCTGG
GAACAGTTGTGCGAGCGGCTTCGCGCTGCGTTTCTCCCGGCGAACGATGCGTTCCGGCAGCGCTCACGCTTCCTCGCCTGTAAGCAAGGGAAGCGCGAGC
TGTACGAGTACGTACAAGAGATGCGCACGTTGGCATCATCTTTGGTGGGGAACCCCCTGCCCGAAGACGTCAAGACGACAGTCTTCATGGACGGCCTGAA
GATCGGTCCCGCACGCACGCAGTTATTCCGCGTGCATGCATCCACTATGGAGGAGGCGATTAAGATCGCCCTCCAGGAGGAGTACAGCCATAAACAGGCT
GGCACCCCGGTTGTTGCGCAACTTGTCATTGCGAACAACGAGCCAGAGCCTATGGACTTGAGCTCTGTTGAGCTTGGCTCGGTCCGCTGCTAAAATGCGG
CGGACTAGGACACTACCAACGTGTGTGTCCTTCGCCTGGGGTGGGGAAGAACCCATCCCTCAAACCCCGAGGGCCTAACGGTCGCTGGCGCAAGCCGCGG
CCAGGTGGCCGAGGGAACTCCGGCCACAAGTAATGGCGGGTTCCCCAGAGGGGGGAGAGTTGAGTCTCCGTGACGGGTGTGCGGGTGGCGCACACCATGG
AGGATTAGCCTACGAGAGACTTATGTCTCGAATCAGGTGATGGCAACGCTGGGTTGCCAGTAGTACACGTGAGTGTACGGGGGTGTTAATATCCCTAGGA
ACGTTTAGTTCAAGGGGCGTCGAATGCTTTCGTACGCCGGAGCGATTGTCAACTCTCTGTGAGAGAGCATCGGCAATGGTATGCGTAGACCTTGCTGTCA
GGTTCACATACCTGAACAGCTGCGACCGTGGACACGTACGGCGTCCGCTTGGGTGCGCCGCGCCATGGACGCACGCACCCTGAAGAAATTGGTGTCGGAA
AGCCATCGAGGCTAACCGGCACCCAGTCTCTGGCAGAGCATTGGTGAGTCATGACCCCACCTCTGCCAGAACACACGGTATCCGAAAGGATTACCAGGAC
GCAATGGCGTCCGCCGACGTACGGAAGTCGTCGGAGTAGTTGCAGCTGCAACAGGTGTTGAGACACCGTCCACTGCGGGCAATGGACCGCCACAGGCAAT
GCCGGTGGACAGGACTAATAGTCCAGCGAGGGGAGCTGCAACGCCAGCAGCACCCACCGCTCCTGATCGTGGCGCCATACAGGCCTCGACTGTATCAGCG
CCAGGGGATGTCAGCTCCCCAGTAGAACAAGTCCACGTGAGGCCAAGACGGTCGAGACCGTGGCCAGGGCTGAGGTTGCCGAGAGCACCTCCTGTGTGGG
TAACAATGTTCCACACGGAGTCGATGAGATTCCCGACTCTGCCCTTGAGTCACCACCGGCCGTGGGTAACGAAGAACCACGCCGGGGTAGGCATTGACGA
CGTCGTCGCCGCCGTAAGCCGAGTCTGTTGAAACAGACTGGAGTCGCCACGAGCGACTCGGAGTAATCAACGCTCCTTAGGCACGGCCGGCCGAAGATGC
TATCACATCTTCGACGGCGAGACCTGTCAGGTCAAGGCGGCGGTCATAAGTTTGACCGCCCTGCCGGAGGTGTCAGAGTTTCTGAACCTCGAGGGAATGT
CGCTGCACGACTTCCAGGTCAGCATGAAGGCTGGGGAGATGGTACTCCTGTAACCGGAGACCTCTCCTGAAGAGTTGAACTCTTCTTCTGTTCTGGACAG
GAACGTCCTGGAAGAGTTCTGTTGACGTAGTTACGCATAACTACGTCAACAGGTCGCAAGACCATGTCCATCGCGGGTAACCCTCGCGGACCGCCAAAGG
CTTAGCCGATGGACAGGGCATCTTGCCCGGCATGTGTGGCTGCGCTGTACCACAGCGACCATCGCCGAGAAGTCGTCGCGCCGTACGGGCTTCGACTTCA
GTAGTGCGGAGTGGCACTACCGGACCGGTGGCTTAAGTCCACGGCCGAGATCGTGGCCAGCTGGAGGTTGCTATAAGCACCTCCTGTGTGGGTAACCAAG
TTCCACACGGAGTCGATAAGACTCCTGGCACCGCCACCAAGACGTGGGTAACTTAGTTCCACGTCCTGATGACCGCCGACGACACCGTCGCCGCCGAAAG
TCGGGTCTGCGCACGTACCAGACCGGAGTCGCAATGAACGACTCGGAGCTATGCTCCTCAGACACACGGTCGGCTCGATGGTGCAGCCGGTTATCAGCTG
CTACCAAAGGCCGAGGTGTCAGCATTGCTGACCCTTGTATGCCAAAGCGCAAGCTGCGCTTGGGTTCCGAAGAACCCAGTGTTTCAATTCACGGCACGAG
TCACATGGTTGACGTCGTGCCTGGCGCAATGTATATCGCCCGGTCGCCCAGACCTTAACTGAAGAGGAAGACGCGGGTTGCGCTACCTGTGTGGGTAACA
TAGTTCCACACACCAGGTGAGCCCATGGTGGCTTCACCCGACGTGGGTAATATCGTTTCCACGTCAAGTCGCACAGACTCAAACTGTTCCCGGGCTGGAT
GAATTCCAGCCGCGGTCGACTCGGTCACCCCGGAGGGGGATCAATCGTAAGAGGGGGAGGGGTTCGGAAATACCTCTCCTCCCAGGTCTCTAGAGAGACT
AGCTTCCTCACGGAAGCTGTTGTTGGCATGAGCCAACAACTGTACAGCATCAGTGCTGCACGCTTGCGGCACTCGAGGCAGCCGTGGTACATTGAACACG
CGGCGTACCTCTGGCGTACGGGAGCACAGCCCCGTACGCCGACGCGGTCGCATGTGGTGATGATTGCCGTGCATACTCGGAACATCTCAATGATCTAGTG
ATAGCCGTAGTACACGGCGAACCACTGACGTATGGGCTCACAGGCCCGTACGCCATCGTGGTCTTGAAAAAGACCGAGTGTCGTGCAGGCTTGCACACAC
TCCGACCGTGCCCTGGTCTTGGCGATGCACGAAGCAATCGCCGGCACCAGAGTGAAGGTGGTAGAGAGTGCATGTAACTCTTCACCATGCTTCAAGTACC
GATGGGTACCTCGGTGTCGATGTCCGACACCGAAGCGTCTATGGTACGACGACCTAGACGCGGGGTGGAGCTTGCTGCTCTACCCGAAATGCTCTTAGTG
ATGAGCAGGCTGCTAATGGCAGCCGTCGTATCACTACGACGAAGCACGATGCTTAGTGCTTTGGTCAACGAATGACCTGAGCGCGTGTACGCCGCCGATG
CTTCACGCGCTCAGCCATGACTAGCGTAACCCATGCGGGTCCGCTATCATGGCAGGAGGTGAGCTGCGAGCTCCCTCCACTCTTGGGCTATGTGATGCCC
GGGATGGTGTCGACCCACACGGGAGACACAAGACACACGAAGTGTCAGGGAGGGCCCACGGCTCCTCCCAAGTGAACTGCAGGTGGTTAAGGAGAACCAC
CGCAAGTTTGGATGCAGTAGCATCCCGTGCCGAAGCGCTGTGCGCTTGCTAGCGCTGCAACACGAGTTGCTAAGGACGTCGGCTTCGCGGCCGACATCGT
CCTTTGTGCAAGGAAGCACCTCGCGGTGTCCGCCACGGACACAAGTCACTGCGTGACTGTCGAGAGGGCGCGCCAGCCGTGCTGTGGCTGCGCCCGGGAA
TTCCCAATTTGGGAGTTCCAATTCCCTCCCTTCTGATTGGAGAATAAGGTGTGATTCTCAGATAAGTGGGGGAGGATGTAACGGGGTACACCGACGTGTA
CCCATGTTACATAAAGAGTGACGGGATGTCTCTCTTTTGTGCCCATGGTACGTGGTACCGGTTGGCGGTGAGCCAACCATTGGGCTTTTACTATAGTTGA
CTTAGAGTTTGTAAGGATCAAGCTTGACTCACCTATAAAATATATTCAGTACCGTCTAAGTCGTAGTCGGTTCCCTTAGACCGGGAACCGTGAACTTGTT
GTTCACCGAGAGCTTACGCTCTCTAGCACTTCCTCTGTGCAAGGTGCTGTGTGCCTCGTCACATAAAGCCTAATGAACCGTCCTGCCTCACAAAGATCGG
GTAAATAGGCGTGTAGCTGTACAGCACCTTGCACAGAGGAAGTGCTAGAGAGCGTAAGCTCTCGGTGAACAACAAGTTCACGGTTCCCGGTCTAAGGGAA
CCGACTACGACTTAGACGGTAGGTTTAAAGACTGAATATATTTTATAGGTGAGTCAAGCTTGATCCTTACAAACTCTAAGTCAACTATAGTAAAAGCTAA
ACAAGTGCCCAATGGTTGGCTCACCGCCAACCGGTACCACGTACCATGGGCACAAAAGAGAGACATCCCGTCACTCTTTATGTAACATGGGTACACGTCG
GTGTACCCCGTTACATCCTCCCCCACTTATCTGAGAATCACACCTTATTCTCCAATCAGAAGGGAGAGAATTGGAACTCCCAAATTGGGAATTCCCGGGC
GCAGCCACAGCACGGCTGGCGCGCCCTCTCGACAGTCACGCAGTGACTTGTGTCCGTGGCGGACACTGCGAGGTGCTTCCTTGCACAAAGGACGATGTCG
GCCGCGAAGCCGACGTCCTTAGCAACTCGTGTTGCAGCGCTAGCAAGCGCACAGTGCTTCGGCACGGGATGCTACTGCATCCAAACTTGCGGTGGTTCTC
CTTAACCACCTGCAGTTCACTTGGGAGGAGCCGTGGGCCCTCCCTGACACTTCGTGTGTCCGTGTGGGTCGACACCATCCCGGGCATCACATAGCCCAAG
AGTGGAGGGAGCTCGCAGCTCACCTCCTGCCATGATAGCGGACCCGCATGGGTTACGCTAGTCATGGCTGAGCGCGTGAAGCATCGGCGCCGTACACGCG
CTCAGGTCATTCGTTGACCAAAGCACTAAGCATTGTGCTTCGTCGTAGTGATACGACGGCTGCCATTAGCAGCCTGCTCATCACTAAGAGCATTTCGGGT
AGAGCAGCAAGCTCCACCCCGCGTCTAGGTCGTCGTACCATAGACGCTTCGGTGTCGGACATCGACACCGAGGTACCCATCGGTACTTGAAGCATGGTGA
AGAGTTACATGCACTCTCTACCACCTTCACTCTGGTGCCGGCGATTGCTTCGTGCATCGCCAAGACCAGGACACGGTCGGAGTGTGTGCAAGCCTGCACG
ACACTCGGTCTTTTTCAAGACCACGATGGCGTACGGGCCTGTGAGCCCATACGTCAGTGGTTCGCCGTGTACTACGGCTATTGTGGCGAAGCGGGATCAC
GAAAATTGCTGTCGTGATATCCGGCTTACCAGCGGTACGCCCGGACTGCCGACTATCGGAGGGGGTACTCCGTTGATCTGGCGCGATCGAAACCTTGTAT
TCACCTTGTGTACCCGACGGCGGGGCGGGTTACGCTCTTCCGGTGTTCACTGAAGGCGTCGGTGGTTACCAAGACGGGGTGGGGAGCTGGACGGCTCCTT
CCGGGGAACTGGGTGGTGACGGCCACGCGGGTATTCTTCACGCGGTCGTCGGTGGTCTGCCGATCGGGGCCTGGTGGGGCTTGATCGGCGTGGGGGGGGT
CCTTGGGTGTGTTCCTTTACGTGCTTGCCGCCTCCTATGGCGGGGTCTTCTGGGGGGAGTTAAGTGGTTGCGCACCTGGCCAAGCGATCCAGGGGCTCCC
GTGTAGTTACCGTGCGCGACGAGGTGAGTCCGAAGTCGTCAGGAGGGCCAATATACTTCCCAGCCTGGAATGAACGAACGCCACTTATGTTGCAAGGGAA
AGCTTCTTCTTCTCTTATCAAGCAAAAGAAACAAACAATGATCTCAGCTTCCTATCCTCCCCCCTTACTGGATTCTTTCACCCATCTCCCGAGGTACCTT
CCAAAGATCTCTCACTCCGGAATGATTGCGGGTGTACCACCAAAGTGGTACGCCCCGATCGACATTTGCGATCGGGATCGCGATCGCAGTTGTGGCCACG
ATCGCATATCGAAATGATCGCACCATACCGCATACCGGTATACACCGATGACTGATGGCGCCACTGTACCCATTGGGACTCCATACCCCTACCCCTCAGG
TCCAATCTAATCCCTCCAAAGTCGGTCTTCATCAACCTCCGATCGTACGTCCGGTCCCGTCCGATCCTAGCCCATCGTTGGTCCATCATGAAATTTCCAA
CATCCACTTCACCACAATCGCCCCCTGTACATGCCGGGGCTGCTCAACAGTCTTGGCGTGCACACTCGTCACTTCTTCTTCTCGCTCCTGGCCACCACAC
CTCCACAGCACCATGTCAGACAACTCTTCGCCGGGTCAGAGGGATTTCACGAGCGATCCTTCTCCTCATTCGCCCCTGTCAGCTTCCTCCCGATCTCCTT
CGTCGCAACAGAGGGTCACGACCTCGGACCCGTCCATCGCAGTTCCTGCAGCTCATGACGCCACTACTACAGTTCCGGCTGTCTTCCTCGGGCCTGTCCA
GCGAATCGAAGGACAGCCTGGCGCTCTCCCGATCGACCCGTTGCCCCAAGTTGGTCCCTCGTTACCGCCCCTGGACCAGACCACCATCCGGAGATCGCTG
GCTGCGGTTGAAACCGCTCTGGATCGCGAGGGTGAGTTTCAGGCACTCCAGCGCAGCTACAACGACTTGTTGCAGTCCTACTTCGCCTTGCGACAGCGTG
TGGCAGACCTGGAGCACACAATTCGATCAGCAGCTCAGTCGGCGTCTCCATTCGACTGCTTCGTCCAACAGAAGTACGACCAGCTGTCTCATCGTCTAGC
GCAGTCCACCCTGGACTTAGCGGAAACCCGAGAAGCTCTGGCTCAGAGGCTCGACAATGCAACTGAGCTCGCCAACCTCCGTGATCGTATGCGCTTTCAA
GATCGCGTACACGCAGAAGTCGTCGCTGACTTCCAAAGAGAAATTGACGATCTGGAGCGGCGTCTGACGGCCGAACTGGCAGTCGCTAGCACGGCTTCCG
GTGGCACCGCTCTACCTCCGCCCGGGGCCAACCCGAACACCCTCCAACTCCAATCACAGCTGAACGTGGCGATCGCAGCCCAAGGTCTAGCGACTCGATT
CGCGATCTCGAGACCTCCCAGAAGGCTCTCGAGGGATCGGCGCAGATCCTCCGGCAACAGGTGGCGCTACTCGAGCGTCGTGCGTCCGAATTGCGCGACC
AGTTGGCGCAAGCCCGACACGGTTCCCGGCATGCCCTCGACCAGAGTATTCAGGAACGACAACGGCTGCAGGACCTACTGGACAAGTCCGACCAAGATCT
AAGCGATCAAGCGACGAAACTGCAGCGGGTGACCCAAGAACGTGACCGCGCTCGGAACGAGCTTTCGCAAGCACGTACGTAACCGTGTCAATCTTTCAGC
GTCCTCTGATCTGATCACGTTCTCTTTCTTGCAGGTAATCAAGTCACTTCCGCCCGACTCTCCATAGCTCGGCTGGAGCAGCGAGCAAGCAGTCTCCAGT
CTTCGGTAGCCGCCAACCACCAGCTGAGCAGCACTAATGCCGTGTTGCGCACCGACCTCGCGACCGCCCGTCAATCCCAACAAGATCTGGAGAGCGTGCG
TGATCAGCTGATCACAGAGCGAGACGGTGCTTTGCGGCGCCTTTTGGACATCACCAGCATACTTCAACCTGGCCCGATCGTTCCTCCGGCGACACCTGTG
CCCACACCGGCCAGCGATCCCTCCCTGCTGAAGAAGACTCCGTCCCGGAAACGTCTCGCCAGCCAATCTCCTTCTCGTCGCTCTCCATCAAGTCCATCGT
CTCGTCGCAGGCGGCCTCACAAGTCTCGACGTCGCCGATCTCCTTCACCCGGCGACAGCGACGATGATGACGCTCTGAACGCCGGTCTCGCTCGATCGCG
TTCCTCTGGTAGACGATCACATTTGTCCCGGTCGAAGCGTCGTGTGGCGTTGGGTTTTGGTGCCGAACTGTCACGGTTTGGCTGACGTTGCACCTTTCAG
TGAACGGCGACAGAGTGTCTTGATTGGCTGGTCTCATTTCCCGCGCTATAGTGACCTAGGAACAATAGTGACCGAGGTCTCGGCTGAGTCTAATAAAACC
CCGGCCTAGGTTAAAAACCTCGTTTGTACCCACTTCGGTGTCGTACCCTCGGCTGTGTAGAGCCGGCTATACGATTTCCCACAGAGATCTGTTTACACTT
GATATTTGTATAGATATATAGGACTAGCCAAATGATGACCTACAGAGGCTCCCAGATCTGTAGGATAAGAAAAATAAATCAGCAGTCTTCCCCACAAGCC
ACCAAGGGTCAAGTCCGTCTTCGGTAAGTCTAGCTAGCTTGTCTTAGGGTCTGGATACGCTCGGCTGCGTGGGATGCCTGTCAGCGAGCTTGAGGTACAT
TGAACCGAGAGTTTGTTGCTGGTCAGTCCAAGAGATAGGAGTGGCCGAGAGATAGGGGCGACAAGGAGTGTCGGTCCCTATATATTGGTGGAACCCGAGT
GTTCCCAAGTGTATTTCACTACCCGCCGAGGTTACCCTCGGCAAACCCGTATTGAGCGTGACTGCCGGTACCCTTACTTCTGAGGGACTGCGGGGGTTCG
CGCGAAAGCGCAATATTGCATTCTAGCCCTCGCTCGTGGCTAGTAGTGCAGGTTCTAAGGTTGACCGAACTCAACCTTGGTATACAGAGGCGCTTACAAC
CAACCCGGTGTAAGGGATCGTTCCTGGTCTTCAGGTGTTGATCCGACGTTCGCTGACCTTTCGCGAGGGAAGCGTGTGTTGTTGGTGGGACTCATACCGT
TCGGTAGTGAGATTTTCTGCGTGTTCCTACACGACAACTGGTGCCGCGACCCGGGATTGGTGTGACCTTCTGTGTGTCTTGGTTGCATATAGGTTCTTAC
CTTAACGAGCATTCGAGAGAAGAAAGAAGAGAAGAAGAAAGAAGATGGCGAAAGAAGCGAAGTCAGTGGTACCAGCAACGCCGGCGAGGTCAAGTGGAAC
GCGTACCGAGGGTTCGGGGCGTTCCGGTTCGTCCTTTGCGACGCCGAGTACGTTGGCGTCGATCAACGAGCGTTCGGACAGTTTTGATGAGCCGATGGAC
TATTCTGACGCCAAGGAAGATGACGACGAAGATGACCTGGAAGAGAAGGCAGCTATGCCCGAGCTTTCGGAAGCCGCTGCAGTATCTGCAGGACGCAGCG
GAGGGGTGAGGTCGCTTGCGCGAAACCTCACCGAAGAGTTGAACGAAGTGGGTGGTCCCGAACCAGCCAACGGTTACGACGAAGATGAGTCCGACGATCA
CCGATCGTCGACGATGGCCGAGGATGCGAATTCTCGGCCGAATGGCGGCCGGCCTCCTCTTAACGGAGACACCCCGGCCGCCAACCGAGTTCTGGGTCGA
TACCTAGAACTCATGAAGGTGAAGAGCAACTGGATGCGATCCTTCGCTCCAGAGGTTGTTCGCCAAGCCATCTGGATGGAGCTCGGTGGCGAGTTAACTG
TGCCCGTGGAGTCGTGGAATACTCGGCAGGTGGCCGAGGACACGGTGCAACTCCTACGCGCTATGGGATGTGAACCCCAAGTGTTCCCGTCGGAAGCAGA
CCTCCGAGCATGGGCACCCGAGGACGCCGCTACGGCGCTTCGCAAGTGGAAGCAGAAGCTTCGGTCGGCCTTCGGGGTGGCCGAGGCGGGAGTTAGCCGT
CCACCGAACGTCCGCCACGCATCGGATCCGGTCGACCCGTCCATGATTCCGTTACCATTGACCCCTGGGAGACGCCCCAGAGAGTCGACCGAGACCGGAA
TTTTTTCGGCCAAGGGAGCGACCTCGACATATTTCCAAGACTCTCACATGGTGACGCCGAGGTCGGTCAGTCGTACAGAACGACTGGCGAGAGAGGCCGA
GGGATATCGAACCGCTCCGACTGCTGGACGAAGTGCAAGTCGGACGCCCAGCCGACGTTACGACCTCCGCGATGACTCATCTGACGAAGATTCGTTCGAC
GTCGGAGACACCGGGGGTGACTTGACGGGAGAATGGGCACGCCAAATTCGTGAGCTGAGCGCTGTGGAAAATGACAGTGCGACACCGAGGCTAGAGATCG
CTACGCATCTCCCACTCGGAAACATCAAGCCGTACTTGGGACTCCGCGATAAGAGCGAGAAGTCCATGCAGTGGCTCCGAGCGTTCATATACGAGATGAA
AGGGACGCACACGCCGCCTAACGAATGGTGCATGGCGTTTGAATTGAGCCTCCAAGATGGTGCTCTGCATTGGTACCGACAGCTGCCCCGCAAAACGAGA
CGCACGTGGAAATTGTTGAGCGATGCGTTCATTAAGTACTACTGTTCGAGGTTCAACCAGTCTGCGAAGGCTCGGTACTACTCGGCCAAGCGAGAGGAGA
AGGAGCATGTCTGCGACTACCTCAACCGACTTAACGGCTATGCTCGCAACGCCGGAGTGCAGTTCGAGCATGGCGGTCGTGATGCAAAGGACCACGTCGA
GCATTTCTTGGATTCGTGCGAAGACCGAGGCCTAGAAGAGCGTCTGTGCCATGTCCGAGTTAAGAACATTCACGACCTCGAGGATATGATCAATGATATC
CTTCGTCGCAGAGAGCGAAAATCTGGACGCGAGTCCTCGGTCCGCCGCCCTCGAGGGCAAGAGGTAGCACGCCGACGCGATGGTGGACGCTCCGAGGATC
CGCGGGACGGCTATCGCCGAGACCGACGTCACCGAGAGGACGACCGTCGTCGAGAAGACCGTTACCGAGACGATAACCGTCGCCGGGATGACTAACAATA
TCGACCGAGGGTCACACTCACTGACGCACTGACCAACATAGTGACAGCACTGAATGCGGGACGCACGGTGGACGCGCGTGGAGGATACCCGGAAGCGTAC
AACGACGGATATGATGACACCGAAGAGTATAGGCCGGAGTCTCACTCTGGCGATGACGACCGATACCCCGAAGGGTACTCGGACGACGGATACGCGTCGA
CCGAGGACCGAGGCCACGTGGCTGCTGCAAACGACTCTGAACGTCGCAATGCGGCTGAAGGAACGTTCGCTCGCGCCGACAGCCGTCGGCCGAGGGCAAG
TAACGGTCAACGCCCGTATGACCGAGACGACCAGCGCCGAAACTCCACCGGACGCGATGGTCGACGCCAATATGGTCCATGCGCCGCCTGCGGAGGACTC
ACCCATTCGGCTCACTACTGCTTTAAGCGATGCAAGATGTGCAAACAGGTTCATGATGCCGGGAAGTGTGAAGCCTTCCAGGAACTCACGAATCTCCTCC
GAGCTAAGGTCGAGAAGAAGGACCTCTCGCCGGAATTGCAGGAACTCGTCTATGGGAGTCATTTAAACTAGGCAGCCCGCCAACTGAAACTGGGTTGGTC
CCAATCGGGCTGCCACAGTTAGCCAAACCTGCGCTGGATGCGGACTATATGTTCGAATTCGCAGGTGTGAGCAACGGCCTGATGACTTGAATATGGAATA
TGTGAAAACGACGGAAAATGTAAAGGAGAGAGACGTAAGCCTCGGTGAGAGTGAAGTGGATGGACGACGTGTGGACGGAGACGGAGTGGAGCTAACCGAT
GCTTCGATCCTTAGCATGGCCAAAATCGACCATCCATCCCGAGACCTCGGCCAGACGATTAAACTGTTATCTGGCGAGAGAATGGGGTGGTGGTCATCCC
AGCGCTATGACAAGAGGAAGCGATTGCGAGCCCTCGTCAATGGGGCTGTAAACGACTCGCGAACGAGGATTCTGCTGGACACTGGAGCGAATGTCAGTGT
GATTTCCGCGTCATACGCGAAACGGTTGCGCTTGCGCGAAGTTCCAGACCACGGTAGGAGTCTGGAAGTGCGAGGAATTAACCCAGGGGTGATGGAGACC
CGCAGACGAGCACTCGTTAAAGTCACGCTAGGCTGGGAGCGCGTGTACGAATTTGAAGTATGGGTTATGGATCACAGTGCAGGAGTGGACGTGGTCCTGG
GAACAGACTTCATGATTCCAGCCGGAGTCCGGTTGGATCTGTTCCACGGTACTGCGAGACTACCGGACGAGGTAATGGTGCCCCTGGTGAAGTCGCAGAA
CCCAGCAGAGGCCGAGCCGTACAGCATGCAAGTGACTGGACGCCCGACCGAAGATTTGTCGGTCCCAGGGCGTGAGTGGCGAGAATTTAGGTTACCACGA
CGACGGCCGCCTCTGACTACTCACGACGTGTGGGCACGCCGGATTGGAAACCTGGTGCCCACTGTAACGAGGTCTCGACGAGGGCAGCCGACGATGGTGC
GACTAACGAACGTGTCACCGAAGATTGCTCACTGCGCGAGACACGAATCGGTACTGCTGTGGGTGAAAAAGGGTGACCTGCCGCAAGGGGATGGATACAC
TCGTTTGAACTCCGCTAAGTATGAGGAGTGGCAAGTCCTGGCGTACGCGGAGTGTCGAGACGAGACTTTGTTCGCGCGGGAACGCAAACTCTACGAACGA
TGGTTGGCAGATCAGCCACCAGCTGTAGAACGACGAGACTATCCGACACCTAGCGGCATCCTACCTCGACCATCCGACGACTTGGAAGGCCTAGACGAGG
GCCAGATAACGTTCGCGAATAGGGGCACTGAGGAACCGGCAGAACGAGACCGAACGCCGTTGACGACTTCGGTGCAACCCTCTGACGAACCCGTTGGAGA
TAGATGGGTCGACGAAGATGACGACTCGGTGGCGACCGACACCTCTGATGGCGCGGATACCACGTATACGAGTGAAGAGAACTCCATCCCAGTCCTCGGT
GATGACCCGGAGACCCGATTGGACTCTGCCTTCGTAGCAATGATGCATGAGATTGCCGCGGGGGACGGTTCAGGTAGTGGGAACACCGATACCAATACGT
CCGAACATTTAGCGAATGAGATCGAGTTGACGGACTATGCACACGAGTTGGCGTTCTTACCGGACCTGACCGAAGCCTCGGAAACGGTACTGGATTATTC
AGGACCGAATGTTCTGAACCCGAGCGCGACAGCCCGTCAACAAGAAAGTCTCGTTGCGGTGCTGAAACGACACGAGAAGATCATGATTGCGAGTGGGAAT
GCTCTGCCACCACCGGCCTACGGTGTGGTGTGCGATATTGACGTACAGGGGCATCCACCCATCAAACAGAGAGCTCGGAGAACACCGCTCCGACACCTTC
GGAAGCTGTACGAGCTTCTGAAAGGCTTGCTGAAAGCTCGTCTAGTGGCGTTTTCGGACAGCCCATGGGCGTCGCCCATCGTGATCGTGCTCAAGAAGAA
TGGAGTTGATATTCGGTTGTGCATCGACTACAAGCTGGTGAATGCAGTGACGGCGATTATGGAGTACGCCATGCCGTTAGTCGACGACTTGTTGACCGAC
CTGGAAGCCTACCTATGGTTCTGCTCACTTGATGCGGCCAGTGGATTCTGGGCTATTATGATGACGATGCGGGCCCGCAAAGTCTCGGCATTCGTCTGTG
CACTCGGACATTTCGAATGGCTTCGTATGCCGTTTGGATTGAAGAATGCACCGATGATTTACCAACGAATGATTGACAATGCTCTGTGGGGTTTCGTCCA
ACCCAAAGGCGGCTGGCTCCACTTTTCGGAGCTTATGCGAACGGCCGAAGCCCACGCCGAGGTTGCGCGGACAGGGGTGACCGACCCTTCATCGCGACGA
CTCGAGGAGTCAACAACTCGGGTGACCAAATTCGAGGCCGACCGCGAATCCTCGGTCACGCTTGACGCAGTGAATGGGTTAGTGAACAGCCCTGTTGCCG
ACATGTTCTCCACCGGAGAACCGGATGAATCCTCGTTGGTGCCAGTGTTCGACCGACGGTCGTTTGTCGATGATATCTGTTTTGGGTCCGAGACTTTCGA
CGCGTGCCTGGAGACGTTAGACCGACTGCTCCAACGGTTCACCGAATGTCGCATTAGTGTGAGCTTTACGAAGAGTATCTTCGTCCAGCCAAAGGTGGAT
TTCCTGTCACACGAAGTCTCTGCAGAAGGTATTCGAGCCGACACCAAGAAGATGAAAGCAGTGACCGAGCTGCCATTCCCTGCTTCGAAAAAGGGGATGC
AGTCTTTCCTCGGTGCGCTGAATTATTACAGTCGATTCATCCAGGACTTCGCAGTGTATGGAGCAGCTTTGTATCAGTTGAAGGATGAAGACTTCACGCC
TAGTGGCAGCCTCTCGGCGGCCAAGCGAAGCTTCGCGGCGCTCCAACAGAAGGTTGCAGAGGCACCGATCCTCCGGCACTTTGACCGAGACAAGGAGGTG
CATGTCACGTTATTCACGAATGAGTGGGCATTGAGCTCCACTTTGATGCAATACCATGATGACAAGCTGCACCCGGTTCGATTTTGTGGCCGAGTCCTCA
AGGACGCCGAGATGAACTACCACCCGGCCGAGAAGGAGGTCTTAGCGCTACTGCTGGTGTTGAAAGTGTGCTACTCCCAGTTGGTGGGTCGGACCATCCG
CGTCTATACGCGTTTTTCGACGCTCGAATGGGTGCACAAATCCAAGACACTGTTCGGTCGAGCGACCCACTTTGCGGTTATGTTGTCCCCGTGGCACCTG
GTGGTCAACCGAGTCAAGGAACGCGATTGCACGTTTGCTCAGCTTCTCCAAGCTGGCCTCACAAGCTTCGTGGAGTTGGAAGACTCGTTGGCCCCAGTTA
CACCGCCGACGAAAGGGTCACCTACTGCTCGTATGGACCCCCACTTGCTTTATGCCTGCCTACCGAGGTCCTATACCGGATTGGTGATGTCGTTCGATGG
TTCGGCCAAGACCGAAAAGAACGGTGGATACGGCAGTTGCTCATGGATTTTGTGGAAATTACCAGAATGGACTGTAGTGACGGCTGCGAGTGCTTATCTC
GAGACCACCACGGTAAACCTCGCTGAGTATGCTGGAATGAACAACGGCGTCTCAGCTGCGCTCGAACATGGAGCCGAGGATTTAGTCATCGTGGGAGACT
CGAGACTCGCAATCCAGCAGTCCCTAGGGGTGATGGCATGTCGAAAGGAGTCTCTGATGGTACAACTGAATCGTCACCGAGAGCTCACGACCAAGCTGCG
GTCAGTGAAGTATCTGCACGTGGTCCGAGAGTTCAACGCTGCAGCAGATTCGTTGGCAGGCGAGGCTCTCAGCAGCAAAGAATCCAGCGTAGCTTCGACC
GAGGCTAGGAAATTAGAATTGGTCGAGCTGAACCGGATCGGAGAGGTCATCTATGAACCCTCAGTACAGACCACGGCCGAAGAGAAACCGACAGTCAGCT
TCGCCCGAGCCAAGTAGCCCGTGGAATCTCCCGCGACAGATCTTTTTTCGACTTTGTGCGGGACGAACCCGACTACCCAACTGCAACAACCAGACACCAA
GCAAAAGCGAGGAAGAAACGAGTCCAGTTTGCAGATGAAATGTCGGTGATAGAGCCGAATGGTACAGATGAGCGAGACGAAGCGAATGGTGTGACCACCG
AAGCTCAGAGTGAGCTGAGAGCCGAGCAATCGAGCAACGAGGTAGACCCTGGCGCTCCAAACGCAGAAGACGTTGACCCTGTGGCTATACAGGAAGAGCG
TCGGAGACGAATCTCCGCCGCCCAGGATGAAGAGCTTGTGAGTTGGGGCGCGGGGGGAAAAAGGGGGGGGGGGGGGGGTTTGGTCGTAACCTAAAAGTCG
CGTCCTTTTCCGGGTCAATGGAATATCTAGCTCTCAATCTACAGAGCAGCCAGAGACGCTTGGAAGATGGCCGACAAGTTCGTGCTTAGCGAGGATGGTG
TACTGTATTTTCTTGGAACGAACCGTCGGTGGGGCAACGAACGCCGAGAGGAGACAACGATGCGTCTAGTGGTGCCCACAACGATGATTCAGGAAGTACT
ACGGAGTTGCCACGACTCGTTGGAAGGTGGCCACCAAGGTATTGGTCGAACGTACCACCGAGTCAAATCAGACTATTTTTGGATTGGACTATATGCAGAC
GCCGAACGGCACGTCAAGTCCTGCCCCGACTGTAGTTCGAGCAAAAGTCGACCACAGTTCCGAGGCTATTCGCCAGGAAACGTCTTGGCAGAGCGACCGT
TCCAGATGGTGTCGATGGATTTCGTCATACCGTTACCGAAGTCTCGTCGAGGCAACTCAGCCCTACTACTGTTCCAGTGCGCATTCACAGGATTCGTCAT
GGGTAAAGCTATGTCGGACACCACCGCTCTGAAAGTCGCACAGGCTTTCGAGGAATGCGTGTACCGAAGATTCGGAGCACCAACTCTAATCCGACATGAC
CGAGACCCTCGCTTCATGAGCGAGGTGTTCCAGGCCTTTGCAGAAATGATGCAGTCTCGGTCAAGAGCGACCCTGAGTTATCGGCCGCAG