Description :
From Genome Similarity Track
Location :
Scaffold_1:3757668- 3765434
Transcript NameFunction/comments
Physo_323024Hypothetical protein
Physo_323025Hypothetical protein

Sequence
7766 bases(100 bases per row)
GCGGCTTCATTGAGCTGCTCGCACGCGTTTCCGCACGGTGGCCAGCGCCGACAAGTAGGCCTGCACGCGCCGACCAATGGCCGGACAGACTCGAGTACCT
CCTGGTCGTGCGAGCATGGTTGGATCCGTGGATGGGATGTAGCAGCGGGTCAGCACGGCACCGAGACTGTGACGAACGCCCAAAGCGGCGAAAAGAAGAG
TGGAGAAGCAGCAAAGAAGAGCAAAAGATGTTCCCACACCGGGACTCGAACCCGGGTCTGCTGGGTGAGAGCCAGCTATCCTAACCGCCTAGACTATATG
GGAAGGCTGAACACCATCGCCACCAACAAACACACAATCAAGACCAACAACAAACAAACACAAACACAAACACAAACACCAAACGCACCACCTACGCACG
CTGCCACACGCAACGCGAGCGCGTTCATCCTATCGCCACCATTGATCGACCGACCATTTCGACACGTACTGCCCACATCCGATCCAGCCACCGACGGGGT
CGCCTCCTTCGCATCGCACGCAGCTCCGAGCGTCGCGTTCGTCTGCTCGCACCGCAGCTCGCCTGGTCGACCAGCTCTCTCGCGGCTTCATTGAGCTGCT
CGCACGCGTTTCCGCACGGTCGCCAGCGCCGACAAGTAGGCCTGCACGCGCCGACCAATGGCCGGACAGACTCGAGTACCTCCTGGTCGTGCGAGCATGG
TTGGATCCGTGGATGGGATGTAGCAGCGGGTCAGCACGGCACCGAGACTGTGACGAACGCCCAAAGCGGCGAAAAGAAGAGTGGAGAAGCAGCAAAGAAG
AGCAAAAGATGTTCCCACACCGGGACTCGAACCCGGGTCTGCTGGGTGAGAGCCAGCTATCCTAACCGCCTAGACTATATGGGAAGGCTGAACACCATCG
CCACCAACAAACACACAATCAAGACCAACAACAAACAAACACAAACACAAACACAAACACCAAACGCACCACCTACGCACGCTGCCACACGCAACGCGAG
CGCGTTCATCCTATCGCCACCATTGATCGACCGACCATTTCGACACGTACTGCCCACATCCGATCCAGCCACCGACGGGGTCGCCTCCTTCGCATCGCAC
GCAGCTCCGAGCGTCGCGTTCGTCTGCTCGCACCGCAGCTCGCCTGGTCGACCAGCTCTCTCGCGGCTTCATTGAGCTGCTCGCTCGCACGCGTTTCCGC
ACGGTGGCCAGCGCCGACAAGTAGGCCTGCACGCGCCGACCAATGGCCGGACAGACTCGAGTACCTCCTGGTCGTGCGAGCATGGTTGGATCCGTGGATG
GGATGTAGCAGCGGGTCAGCACGGCACCGAGACTGTGACGAACGCCCAAAGCGGCGAAAAGAAGAGTGGAGAAGCAGCAAAGAAGAGCAAAAGATGTTCC
CACACCGGGACTCGAACCCGGGTCTGCTGGGTGAGAGCCAGCTATCCTAACCGCCTAGACTATATGGGAAGGCTGAACACCATCGCCACCAACAAACACA
CAATCAAGACCAACAACAAACAAACACAAACACAAACACAAACACCAAACGCACCACCTACGCACGCTGCCACACGCAACGCGAGCGCGTTCATCCTATC
GCCACCATTGATCGACCGACCATTTCGACACGTACTGCCCACATCCGATCCAGCCACCGACGGGGTCGCCTCCTTCGCATCGCACGCAGCTCCGAGCGTC
GCGTTCGTCTCCTCGCACCGCAGCTCGCCTGGTCGACCAGCTCTCTCGCGGCTTCATTGAGCTGCTCGCTCGCACGCGTTTCCGCACGGTGGCCAGCGCC
GACAAGTAGGCCTGCACGCGCCGACCAATGGCCGGACAGACTCGAGTACCTCCTGGTCGTGCGAGCATGGTTGGATCCGTGGATGGGATGTAGCAGCGGG
TCAGCACGGCACCGAGACTGTGACGAACGCCCAAAGCGGCGAAAAGAAGAGTGGAGAAGCAGCAAAGAAGAGCAAAAGATGTTCCCACACCGGGACTCGA
ACCCGGGTCTGCTGGGTGAGAGCCAGCTATCCTAACCGCCTAGACTATATGGGAAGGCTGAACACCATCGCCACCAACAAACACACAATCAAGACCAACA
ACAAACAAACACAAACACAAACACAAACACCAAACGCACCACCTACGCACGCTGCCACACGCAACGCGAGCGCGCGTTCATCCTATCGCCACCATTGATC
GACCGACCATTTCGACACGTACTGCCCACATCCGATCCAGCCACCGACGGGGTCGCCTCCTTCGCATCGCACGCAGCTCCGAGCGTCGCGTTCGTCTCCT
CGCACCGCAGCTCGCCTGGTCGACCAGCTCTCTCGCGGCTTCATTGAGCTGCTCGCTCGCACGCGTTTCCGAACGGTGGCCAGCGCCGACAAGTAGGCCT
GCACGCGCCGACCAATGGCCGGACAGACTCGAGTACCTCCTGGTCGTGCGAGCATGGTTGGATCCGTGGATGGGATGTAGCAGCGGGTCAGCACGGCACC
GAGACTGTGACGAACGCCCAAAGCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNAAACACAAACACCAAACACCAAACGCACCACCTACGCACGCTGCCACACGCAACGCGAGCGCGTTCATCCTATC
GCCACCATTGATCGACCGACCATTTCGACACGTACTGCCCACATCCGATCCAGCCACCGATCGGGTCGCCTCCTTCGCATCGCACGCAGCTCCGAGCGTC
GCGTTCGTCTGCTCGCACCGCAGCTCGCCTGGTCGACCAGCTCTCTCGCGGCTTCATTGAGCTGCTCGCTCGCACGCGTTTCCGCACGGTGGCCAGCGCC
GACAAGTAGGCCTGCACGCGCCGACCAATGGCCGGACAGACTCGAGTACCTCCTGGTCGTGCGAGCATGGTTGGATCCGTGGATGGGATGTAGCAGCGGG
TCAGCACGGCACCGAGACTGTGACGAACGCCCAAAGCGGCGAAAAGAAGAGTGGAGAAGCAGCAAAGAAGAGCAAAAGATGTTCCCACACCGGGACTCGA
CCCGGGTCTGCTGGGTGAGAGCCAGCTATCCTAACCGCCTAGACTATATGGGAAGGCTGAACACCATCGCCACCAACAAACACACAATCAAGGCCAACAA
CAAACAAACACAAACACAAACACAAACACCAAACGCACCACCTACGCACGCTGCCACACGCAACGCGAGCGCGTTCATCCTATCGCCACCATTGATCGAC
CGACCATTTCGACACGTACTGCCCACATCCGATCCAGCCACCGATCGGGTCGCCTCCTTCGCATCGCACGCAGCTCCGAGCGTCGCGTTCGTCTGCTCGC
ACCGCAGCTCGCCTGGTCGACCAGCTCTCTCGCGGCTTCATTGAGCTGCTCGCTCGCACGCGTTTCCGCACGGTGGCCAGCGCCGACAAGTAGGCCTGCA
CGCGCCGACCAATGGCCGGACAGACTCGAGTACCTCCTGGTCGTGCGAGCATGGTTGGATCCGTGGATGGGATGTAGCAGCGGGTCAGCACGGCACCGAG
ACTGTGACGAACGCCCAAAGCGGCGAAAACAAGAGTGGAGAAGCAGCAAAGAAGAGCAAAAGATGTTCCCACACCGGGACTCGACCCGGGTCTGCTGGGT
GAGAGCCAGCTATCCTAACCGCCTAGACTATATGGGAAGGCTGAACACCATCGCCACCAACAAACACACAATCAAGACCAACAACAAACAAACACAAACA
CAAACACCAAACGCACCACCTACGCACGCTGCCACACGCAACGCGAGCGCGTTCATCCTATCGCCACCATTGATCGACCGACCATTTCGACACGTACTGC
CCACATCCGATCCAGCCACCGACGGGGTCGCCTCCTTCGCATCGCACGCAGCTCCGAGCGTCGCGTTCGTCTGCTCGCACCGCAGCTCGCCTGGTCGACC
AGCTCTCTCGCGGCTTCATTGAGCTGCTCGCTCGCACGCGTTTCCGCACGGTGGCCAGCGCCGACAAGTAGGCCTGCACGCGCCGACCAATGGCCGGACA
GACTCGAGTACCTCCTGGTCGTGCGAGCATGGTTGGATCCGTGGATGGGATGTAGCAGCGGGTCAGCACGGCACCGAGACTGTGACGAACGCCCAAAGCG
GCGAAAACAAGAGTGGAGAAGCAGCAAAGAAGAGCAAAAGATGTTCCCACACCGGGACTCGAACCCGGGTCTGCTGGGTGAGAGCCAGCTATCCTAACCG
CCTAGACTATATGGGAAGGCTGAACACCATCGCCACCAACAAACACACAATCAAGACCAACAACAAACAAACACAAACACAAACACCAAACGCACCACCT
ACGCACGCTGCCACACGCAACGCGAGCGCGTTCATCCTATCGCCACCATTGATCGACCGACCATTTCGACACGTACTGCCCACATCCGATCCAGCCACCG
ACGGGGTCGCCTCCTTCGCATCGCACGCAGCTCCGAGCGTCGCGTTCGTCTGCTCGCACCGCAGCTCGCCTGGTCGACCAGCTCTCTCGCGGCTTCATTG
AGCTGCTCGCTCGCACGCGTTTCCGCACGGTGGCCAGCGCCGACAAGTAGGCCTGCACGCGCCGACCAATGGCCGGACAGACTCGAGTACCTCCTGGTCG
TGCGAGCATGGTTGGATCCGTGGATGGGATGTAGCAGCGGGTCAGCACGGCACCGAGACTGTGACGAACGCCCAAAGCGGCGAAAACAAGAGTGGAGAAG
CAGCAAAGAAGAGCAAAAGATGTTCCCACACCGGGACTCGACCCGGGTCTGCTGGGTGAGAGCCAGCTATCCTAACCGCCTAGACTATATGGGAAGGCTG
AACACCATCGCCACCAACAAACACACAATCAAGGCCAACAACAAACAAACACAAACACCAAACGCACCACCTACGCACGCTGCCACACGCAACGCGAGCG
CGTTCATCCTATCGCCACCATTGATCGACCGACCATTTCGACACGTACTGCCCACATCCGATCCAGCCACCGACGGGGTCGCCTCCTTCGCATCGCACGC
AGCTCCGAGCGTCGCGTTCGTCTGCTCGCACCGCAGCTCGCCTGGTCGACCAGCTCTCTCGCGGCTTCATTGAGCTGCTCGCTCGCACGCGTTTCCGCAC
GGTGGCCAGCGCCGACAAGTAGGCCTGCACGCGCCGACCAATGGCCGGACAGACTCGAGTACCTCCTGGTCGTGCGAGCATGGTTGGATCCGTGGATGGG
ATGTAGCAGCGGGTCAGCACGGCACCGAGACTGTGACGAACGCCCAAAGCGGCGAAAAGAAGAGTGGAGAAGCAGCAAAGAAGAGCAAAAGATGTTCCCA
CACCGGGACTCGAACCCGGGTCTGCTGGGTGAGAGCCAGCTATCCTAACCGCCTAGACTATATGGGAAGGCTGAACACCATCGCCACCAACAAACACACA
ATCAAGACCAACAACAAACAAACACAAACACAAACACAAACACCAAACGCACCACCTACGCACGCTGCCACACGCAACGCGAGCGCGTTCATCCTATCGC
CACCATTGATCGACCGACCATTTCGACACGTACTGCCCACATCCGATCCAGCCACCGACGGGGTCGCCTCCTTCGCATCGCACGCAGCTCCGAGCGTCGC
GTTCGTCTGCTCGCACCGCAGCTCGCCTGGTCGACCAGCTCTCTCGCGGCTTCATTGAGCTGCTCGCACGCGTTTCCGCACGGTGGCCAGCGCCGACAAG
TAGGCCTGCACGCGCCGACCAATGGCCGGACAGACTCGAGTACCTCCTGGTCGTGCGAGCATGGTTGGATCCGTGGATGGGATGTAGCAGCGGGTCAGCA
CGGCACCGAGACTGTGACGAACGCCCAAAGCGGCGAAAAGAAGAGTGGAGAAGCAGCAAAGAAGAGCAAAAGATGTTCCCACACCGGGACTCGAACCCGG
GTCTGCTGGGTGAGAGCCAGCTATCCTAACCGCCTAGACTATATGGGAAGGCTGAACACCATCGCCACCAACAAACACACAATCAAGACCAACAACAAAC
AAACAAACACAAACACAAACACAAACACCAAACGCACCACCTACGCACGCTGCCACACGCAACGCGAGCGCGTTCATCCTATCGCCACCATTGATCGACC
GACCATTTCGACACGTACTGCCCACATCCGATCCAGCCACCGACGGGGTCGCCTCCTTCGCATCGCACGCAGCTCCGAGCGTCGCGTTCGTCTGCTCGCA
CCGCAGCTCGCCTGGTCGACCAGCTCTCTCGCGGCTTCATTGAGCTGCTCGCTCGCACGCGTTTCCGCACGGTGGCCAGCGCCGACAAGTAGACCTGCAC
GCGCCGACCAATGGCCGGACAGACTCGAGTACCTCCTGGTCGTGCGAGCATGGTTGGATCCGTGGATGGGATGTAGCAGCGGGTCAGCACGGCACCGAGA
CTGTGACGAACGCCCAAAGCGGCGAAAAGAAGAGTGGAGAAGCAGCAAAGAAGAGCAAAAGATGTTCCCACACCGGGACTCGAACCCGGGTCTGCTGGGT
GAGAGCCAGCTATCCTAACCGCCTAGACTATATGGGAAGGCTGAACACCATCGCCACCAACAAACACACAATCAAGGCCAACAACAAACAAACACAAACA
CCAAACGCACCACCTACGCACGCTGCCACACGCAACGCGAGCGCGTTCATCCTATCGCCACCATTGATCGACCGACCATTTCGACACGTACTGCCCACAT
CCGATCCAGCCACCGACGGGGTCGCCTCCTTCGCATCGCACGCAGCTCCGAGCGTCGCGTTCGTCTGCTCGCACCGCAGCTCGCCTGGTCGACCAGCTCT
CTCGCGGCTTCATTGAGCTGCTCGCTCGCACGCGTTTCCGCACGGTGGCCAGCGCCGACAAGTAGACCTGCACGCGCCGACCAATGGCCGGACAGACTCG
AGTACCTCCTGGTCGTGCGAGCATGGTTGGATCCGTGGATGGGATGTAGCAGCGGGTCAGCACGGCACCGAGACTGTGACGAACGCCCAAAGCGGCGAAA
AGAAGAGTGGAGAAGCAGCAAAGAAGAGCAAAAGATGTTCCCACACCGGGACTCGAACCCGGGTCTGCTGGGTGAGAGCCAGCTATCCTAACCGCCTAGA
CTATATGGGAAGGCTGAACACCATCGCCACCAACAAACACACAATCAAGACCAACAACAAACAAACAAACACAAACACAAACACAAACACCAAACGCACC
ACCTACGCACGCTGCCACACGCAACGCGAGCGCGTTCATCCTATCGCCACCATTGATCGACCGACCATTTCGACACGTACTGCCCACATCCGATCCAGCC
ACCGACGGGGTCGCCTCCTTCGCATCGCACGCAGCTCCGAGCGTCGCGTTCGTCTGCTCGCACCGCAGCTCGCCTGGTCGACCAGCTCTCTCGCGGCTTC
ATTGAGCTGCTCGCACGCGTTTCCGCACGGTCGCCAGCGCCGACAAGTAGGCCTGCACGCGCCGACCAATGGCCGGACAGACTCGAGTACCTCCTGGTCG
TGCGAGCATGGTTGGATCCGTGGATGGGATGTAGCAGCGGGTCAGCACGGCACCGAGACTGTGACGAACGCCCAAAGCGGCGAAAAGAAGAGTGGAGAAG
CAGCAAAGAAGAGCAAAAGATGTTCCCACACCGGGACTCGAACCCGGGTCTGCTGGGTGAGAGCCA