Description :
From Genome Similarity Track
Location :
Scaffold_32:375704- 379069
Transcript NameFunction/comments
Physo_134539hypothetical protein
Physo_134540hypothetical protein

Sequence
3365 bases(100 bases per row)
ACGTTTACGACCTCAAAGTTCCCAGAGGCCAGGCGAAGTAGAAGCAAATGTCCAAAGTTCACATTCTTCACAACGCGCGCGCCCACGACATTAGACACCG
CAGAGGCTGTCGACGACGATGAAGCGGAGGCAGTATTTCCGCTGCTGGGTGATACACTGAAGACGTGGCGAGCCGAACTCTTCGGCAATGTCGTGAACTG
TTTGCCGGAGGCGAGAGCAAACACCCAGCTCACATTGATCACGTGCACGCCCGTCGAGTGCAGGCAGTAAACAAGCTTCGGATCAGCAGTGTCCCGCTCA
AGCACAGCCTTACCACCAGAATCGTCAATGCCAAGGTTAAGACACTCGAGCAGTAGTGCCGGAAGTTTACGCGCGGATGAGGCAGTGGCTCCCTGGCGAT
TGCTTCTCCACTGTGGTCGGATAGGGGAGTCCAGCAGAATAAGCTCTACATGGCCCGAAGTGAAAGCGCGCATCAAGAAAGGCGAAGAGCTGGCGGCGCG
CTTCTCCACGGAACTTCGCAGGGCATGCGGTACAACAAGCAGCGAGGTTGCCGACGAGCCACCTGCAACCTGGTTCTTGCCTTCCACAACCGATTGGGGA
GTCACGTCCACGGGTCCTTGCAGGGCAATTGGCCACGTATCCGGCGAAATGCCGCTCACATGAGGGCTCAGGTAGCAAAATACGTCCGCATTGGATTTGT
CTTGAGTAGCGGGGGGAGTTTGTGTGCGTCCGCCAAAGCGAGGGCTGCTACGACGAGCCTGTGCGGAGGCCGGCGCCCAACCTTCCTGCAACCAGTACTT
CTGTGACTTGAGCTCTAGAAGCCGCGACTGCAGCCCGCTGCCACCGCTAGCTGCTTCCAACTTCTGCTTGCAGACGGCGATCTGGGCGTCCACTTCGCTA
TTCAACATCTGAAGGAACATCTTGCTAGCGCAGCAATCGTACGGCACCAAGGGGCACAGAGCATACACGGCGCCGTCCGAGCGCAAGACGTAGCACGTGA
ACGCATCCCAAATCTGCGCGGCCTGCAGTTGTGCGGCCTGTTGCTGCTGGAGCTGAATCGAAGCACCGAAACAGAAGCTCGTTGAGAAGGCCCCCGTGGC
TCGAGCCTTGGTCGGGAAGTCCAGTCGGTGGCGCTGCTCCGGCTTGGATACATCCTGCTGCGTGTTGAACACCTCGATCTCCTCCGCGTCCGAGAGCACC
ACCACGTGCGTGTCGCTCAGTGGGTGCCATGCCGCGTGGCGCACGTTGGAAAAGTATCCGACAGTCCTCACTGACGCCACACAGTGCTCGCGCGACACGA
ACGCCACGCGCTTGCCCTGTGCCGCGCGGCGTCTGACCTGCGTCACCATGTCGGCGTCCTTGAGCTCGTCCTCCTTGAGCGTGATCTCCTGCTCGCTGCC
GTCCTCGAACCTCACCAGGAATCTCTGCGTGATGTCGTTGTCCGCCCTGCGCTGCAGCGCGCTCTGCGGCTTGCGCTTGGTTTCCACGGGCAGACGCAGC
AGCCTGAGCCAGCTCTTGGCCTGCAGCAGCACCTGCGAGCTGCTGGCGTTGAGCTTGATCTGCTCCACCTCCGCCGCCTCCTGCGGCTGCAGCGGCGGGT
CCAGCGTCACGTGTCTCAGCAGCTTCTCCTTGCTGGTCTTGGAAGCCGCCTGCTTGCCGCCGGCCTGGCTCTGGTGGAACACGTTGACCAGGAAGAGCTT
GCCGCCTTCGCCCCAGAGCGCCGCGCCGCCGTCGCGCACGTCGAAGGTCTGCAGGTGCGCGGCCGTGCGCAGGTCCGCGTAGGTGGGGGGAGACACAGAG
CCGCACAGCTGCAGGTTGGCGCGCAGCGCCCAGTCATCTCCGGAAGAGGAGGAGGAGGCGGCGGCGCGCATGATGTGGCCGAGTGGGTTGGGTTGCTGCG
TTGCCAGTGGCTTCGGCTTGGGGCCATGGGCCACAGTATGCACAGATGTGGTACCGAATCCGTTTTGTGTCTCTAGGCTATTGGTAATTTACGACAATAA
ATTACGATGTACTTTGCTGCAGAGTCCTTCGAGCACATGAGAAAAGCTGACGCCTCGAAGGGTCGATGCATGTACCTGAGCAAGAGATCGCTAGCGTCCA
CGGGTCAACGCATAGATTGGCTGCAAATTACGACCCAACTACAAAAATGATATGAAACTTAACTTACCGAAGTATCCAATCAGATTGAGATCGCCCCGAA
TCACGGAGCAATGGAGTCGACAGTCTTCGTCTGCGTCTCGGTGGGCGCGGCCAGCCTGCTGCTGGTCTTGGATGGAGCAGGTGCGGTGGATGTGTCCACA
GTGTGATCGCTTGCTTGGCGACTGACTGCGTGTGTGCAGCCTGCCTGCTGGACGTCGAGAACGCGTGCCTCGCAACGCGATCCAGCAGCATTGTCATGGT
GATAATCGGAGCTTCAACATTAGTCCCGATTGCCGGCTGTCTCTACGCGGCGTGGCTCGACGGTTGTGAAGCGGACGGGCAGGAGCAGACTCGATTGCTG
CAAGTATAGTTCCTCGCTGTCAACGCGAGCTAAGTGAGGTGGCGGTTCTCTAACGTCGTGGGTTTCCATTTGCTCTTATCTATGGATTATTGCAGCGAAG
AGCACGACGAATACCTTCCTCAGCGTCGGAAGCAGTCTCGGCGGGTGCTGGCGTACCTGTACGCCGGCCATTTGCTCTCGGCGTGGGTACGTGTCACTGT
CTAACTAGCTGGCACGCTGTGTATGTGGGGGGGGTCCTTTTACCGAGTGCTGACGAGAGCGATCTGATGCAGGGCGATCGAATGTGGGAGTTTGCCGTTC
CGATCCTCTTTATGGAGATCTTTGTTGACACACTGCTGCCTAGTGCGTGCTTCTCGCTGGTCATGTACGCCACCTGCCTCCTCGCGATCCCGTGGGTCGG
CAGACAGCTTGACGCGGCAAACCGCTGGAAGGCGATGCAGTTCGCCATCATCCTGGAGAACGCTAACATCATCGCAAGCACCATGCTGCTGGGATCGATA
TTGCTGATCACAAATGCTGATGGACTGCACAAACCAGAGTGGACTTGGCCGTTGACGCTGCTCTTCATTGGGACTCTCGTCTGCGGAGGTGTAGGCCAAG
TACTCAGTGAGGCGCAGACGCTCGGGATCGAGCGCGATTGGGTTGTAATCATCGCCCAGAGCAGCGGAGAGGACCGCTCTTCTGCGCTGGCGAGCCTGAA
CACCATCCTGAGGCGCATCGATCTGGCATGTAAGCTGCTCGGACCTCTTGCTTTTGGTGTCATTATGGACTTTGCCGGGCATGACCCCACTACGCGTGCT
ATGATCGGAGCGTCCACAGTTGCAATCTGGAACGCGTTGTCCACTCCGCTCGAATACTTCATGAC