Description :
From Genome Similarity Track
Location :
Scaffold_113:37570- 40174
Transcript NameFunction/comments
Sapdi_VS20SDRG_16107hypothetical protein

Sequence
2604 bases(100 bases per row)
AGGTTAGGTCGAGCGCCATCAATGGCGTCTCGGTCTCGCTCAAGCAGCTCTGGCGCTTCTCGGCCGTCATGGTCACATAGTCTGCGCCCAGTGTCACGGT
AGTCGACGTCAGACTCCACTCAAACTGGAGCCTTGTCGGCGTCGTCGCTGTCATCTGCACGCGCGCGATGTAGGCTGTCGACGACTGCTGCAGCGGCCAG
GCGTAAAACGTGAGGCAAATGACGCCCGGCGACCGCACGCGACCAATGTAATCGCCGTGGAGCCAGGACGCACTCCACTCGCGCAAGGTGTTGGCACCGT
TAGGAAAGACGCGCGCGACGCGGAGGCGGTCGTCCAGCGTGTACGTCGACCAGATGGTCGAGTGAATCGCGAGGTCGGAGCGCACCTACATCCGCCTCGT
CACGACAACGCGTCATCACAATCTCAGAACGTACGTGCAAGACGTTGTGGGCATCAAGGTACTGTCGAAAGCAGTACGCCATCGTGACCCACTGGAGCAT
TGGCAGCACGGGTGCGGGGACGCCGGGGTGGTGCGGCGGCAAGATCGCGCAGAGCCAGCGCCCGTCGAACGGCGACAATTGCTGGTGCAGCGGCCACACT
TCCTGGGGCTGCGCTTTGGCCTACACGGTTTTTGTAGGAATTTGACAATATAGATAGGGGTTGGGGTCCACCATGTAGAGCTCGCGCAGCTGCGCGACAA
ATGGCTCAAACAAGGACGGAGACGGCGTGCTTTGGAGGTGTGGCGCGATCGATACGACGTCGCGCACGAGCTGCGTATACGAGTCGTAGCGCGACGATGT
TTGCAGCCACTGGTCTATATAAGCCGCGACAAGCCTCTTCCATGCCTCGTACAAGGTCGTGAGCCGGTCTCTGTCCAAGAGGCAGTCGGCGTCGTAGAGA
CAGAGCGCTTGGAGTTGCTGGACGAGGTTCGGGTCGAGCAACGACGTCGCGACGCCGAGGCACGTAGCTTCCAACGTCGTGACAAGGAGCGATGCCCGGT
CGACTAGCGTGTACCGTCACACCTCATTTTGAATGCCGACGATCGTACCAGCCAACGGCAGAATGCGCGCATGTTCGGTCAGATATGCTTCGGTCAACGG
CATATGAAGGCGCGCAAAGAGCGGCTTGAGCAGCCGCGACTGCACATGGCGGCTCGCGATGGCGCCGCCGACACCAGGCGGTAGCGCGCTCACAAACGCC
AGAATGATACCCAACGAGACGTCAAATGAAGTTGAAGCAGGTGGCGACGGCGGCCGGGGCATTTGCCGGATGGCGAAGGCAGGTGATCGGGCGGACGCAA
CGACTTGGAGAACCGTGTCGGGGCCTTGCTGGCATCGGACAAAGAGATACGCCTAGCACACGCCGATACCGTCGCCTCGAAAAACAAAAAAGGTGTTAAA
GGTGTGTACCGTCAACGTCGCCGCAGGCCACACTTGCGACCACGAGAACGACCAATCTTGCGTCAGCGGCACGTACGTACAATGCGCGAGCCCGGTAGCC
TAGTCCATATAGTGTCCAAGTTCAAAAGTATACGAGAATATTCTACCTGGTCGAAAATATACTCTTGGCTTGGCAGCCACGTGCCAGTCGGATGGCTCGT
CGACTGCACGTCGTCGACTATGCAGGCGCAGGGCACTTGGTCCCCGATTTGGAGCGCGTTCAGCTCGGTCTCTGCGGGTTCAAACCGAAGGAAGACCACG
TGCTGCGCGACGTCGGCTGGCGTGACATTGGCGAGTGCAAACTCGACTGCGAGCGCACCACGCGGCGTCTGCGTCGGGCACTGGTGCGGGAACGATCTAC
AAGCTTGTGTCAAATTCAACTGCCGCGATATCTGAGTGTACGGGAGGACCTAATCCAAGGCACAGGTGAGTGAGTCGTCGATACCAACGTGCAGCGGAGA
GCGTACGATTGGTCGGGGCGGCAGCGATAGCGGAAGCCGCCTACACCGTGTGTAACTTCTCGAGTCTGGCAGTCGTCGTTGCCTACGTGGGCGTATCGTA
GCCGCCTTCAAACGGCGTCGCCCGAGGGCAGACGCACGAGGGCATGTAGAATTGCAGCGAGGACATCGCGCGGTGTCGCTGTCGCCGGCTTGTGATGTGA
TGATACCCAAGGTGAAGCGGTGGTGGTACCTGCGCGTTCCGGAGCAGAAGGAATAGTGCGATGACCAGTCACGGAAATGACACGCGCGCGCTTCGCACCA
TCTGGATCTTGCAAGTTGCACTTGGTCCTGTCATATTCGGGACCTGTCTTGAATTTTAAAAAAGCGACTCGAAGCCAACCGAGACAGCGCCGAGTCATCA
CGAAACTTGGCCGAAGACGGCGACCACGACGACAACGTTGGTCCTGCGGCAGGTACTTGAGAGCTACTCGTAGCGTGCCCTGATGACGGTACAATAGAAG
GAAGGATTCGCTACTCACACGCCAAGCAGGAAGCGGCAGTTCTTTTCGCTGTCTCTCAGCGCCGAGCGCCGCAGAGGCGGCCTGCGATGGCGTCATCGGC
GCTGGCCGTTGGACTGCACTTGTCCACCTGCCGCCATCTCTACCGCTTCTGCGTTTACAAATCGGTGGCTGGAATATGCAAATAACGTAGTTGGTAGTGC
TGGT