Description :
From Genome Similarity Track
Location :
Scaffold_487:3757- 4974
Transcript NameFunction/comments
Phypa_INRA-310PPTG_20332hypothetical protein

Sequence
1217 bases(100 bases per row)
GACAAACCAATCGGTGTGATGGGTAACATGGCACGTTCAGCCAGAGTCAACAGGCCAGTTCGAGTCAAAGTTGGAGGTAGCTTGAGCAGTAAGGCTGATG
GTAGGTGGCACAGGTTAGACTATATTAACAACCGCAATGCGTGCGTCTTCACGGCGCGACCGATCGTGTCCATCTTCTTAACAGCGAGGTTGCTGATGTC
CTTCCTTGCTGCCATTGTTACCACGAGCATTATTGCCAAGATCACCATTGTTTCGACTGCTTCGACGACCGCCTTTTTGCCACGACCTACAACCACGGCT
CGAGCCGGTGTCATTTCATTTATAAGGGTGGAAGCAGTTCCAAATATACCCTGGCTTTCAAAGTTTGCCGGCAGGCCTGCTTTTACATTCCCTTTGCAAT
CCACGACACTGTCGGATGTGATGGCGGGGTTCCTGGTAGTAACTGCATACCTCTCGTAGGAGACAACGCGCTCCATGCCCTGTGCCGGAGAAAGAAGTGC
ACGCTCGTTCTTGGTACTGTAGTTTTCTGGGGTACCCTTATCCATGGTGCAGCGTGTTTGCTTCTCCATCTTACGGATCGTGTCTTCGATGCTCATGTTG
AGCTCGTCGTACGGGATGTACTTCCGATCACCATTCCAGATGCGGAGGTCGCCTTTCCAAGACGCTTTCTGTCCATCAGTCAGGACCGATTCGGTCGCTT
TTGACATCGCGTCTTGCTGAATGAGGAAGAACTCGTTGACGTCACTTCCTTTCTCATAATTTGTTACCATCAGAAAATGCTGGATAAAATACGGGCCATC
GCAGAAAGGCTACCTCGTACTTCTTACAGATAGTTTGAAAGATGTCATAAGCCGAGGTCTCGTTTTTTACTAGACGGATATGCGTGCCATCCATTGTCTT
TATGAGGAAAGCCTTGGTTTGCACTTCCATGCAGCGTAGACGCCGTGGCAGTGATAACGTCCGCTTTTCCTTTTAGTTTGGCGTTGAGGCTTGCGTTGCG
CGAACGAGCGGATGCGGAGGGTGCTTGGACCTTGAACCTTTCGTGGTACCTCCCTCGCCGTCACTATCCGACTGAGCTTGACTCGCAGTCGACAGCACCC
GAGTCGTAGCCGAGGGTCTTGCGGACGTTGGGACTCTCTTCGTCGTCCGGAATTCCATTGTAGTCCCTCTTGTTGACGAAGCCGAGAAGGTGCTTGTTAT
CAAGCGATGCTATCACT